Mutagenetix > Incidental Mutation

Incidental Mutation 'R7218:Filip1'

561604

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R7218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79818074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1088 (S1088G)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000093811
AA Change: S1088G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: S1088G

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	T	C	17: 45,733,051	T94A	unknown	Het
1700025G04Rik	T	C	1: 151,915,508	R101G	probably damaging	Het
6430548M08Rik	T	A	8: 120,145,583	S83R	probably damaging	Het
9130019O22Rik	A	T	7: 127,384,680	S417T	probably benign	Het
A430089I19Rik	C	A	5: 94,303,254	V338F	probably benign	Het
Actn2	A	G	13: 12,278,913	S574P	probably benign	Het
Ank	A	T	15: 27,544,321	Y56F	probably damaging	Het
Ano7	A	G	1: 93,380,469	D74G	probably benign	Het
Apaf1	T	A	10: 91,037,002	T738S	probably damaging	Het
Apcs	A	T	1: 172,894,664	D38E	possibly damaging	Het
Arntl	A	T	7: 113,287,183	H149L	probably damaging	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Atp8a1	T	A	5: 67,702,981	D717V		Het
Baiap2l1	A	G	5: 144,275,877	S443P	probably benign	Het
Brix1	T	C	15: 10,483,292		probably null	Het
C1qtnf6	T	C	15: 78,527,374	E34G	probably benign	Het
Chil3	A	C	3: 106,160,537		probably null	Het
Chmp4c	T	A	3: 10,367,138	L36Q	probably damaging	Het
Chrna2	T	A	14: 66,143,871		probably null	Het
Clec1a	C	T	6: 129,436,955	C57Y	probably damaging	Het
Clec7a	G	T	6: 129,468,922	T95K	probably damaging	Het
Csf1r	C	A	18: 61,130,324	S926R	probably damaging	Het
Dnajc9	A	G	14: 20,388,439	I61T	probably benign	Het
Extl1	T	G	4: 134,359,769	S493R	probably benign	Het
Fance	A	G	17: 28,326,174	D143G	probably benign	Het
Fcho2	C	T	13: 98,753,613		probably null	Het
Gm10696	A	T	3: 94,175,549	H318Q	possibly damaging	Het
Gnat1	A	C	9: 107,675,985	M319R	possibly damaging	Het
Gpr132	A	T	12: 112,852,429	V259E	probably damaging	Het
Gprc5d	T	A	6: 135,116,454	M152L	probably benign	Het
Hif3a	C	T	7: 17,050,588	R244H	probably damaging	Het
Hivep3	T	C	4: 120,095,452	S322P	possibly damaging	Het
Il33	T	A	19: 29,958,925	F229I	probably damaging	Het
Il4ra	A	G	7: 125,575,778	D386G	probably benign	Het
Ino80	G	T	2: 119,458,127	H33N	probably benign	Het
Ip6k1	A	G	9: 108,045,582	D228G	unknown	Het
Mamdc2	C	T	19: 23,447,610	A40T	probably benign	Het
Meis3	T	C	7: 16,184,701	V357A	probably benign	Het
Mycbp2	T	C	14: 103,133,846	T4199A	probably benign	Het
Myo7b	A	T	18: 31,981,001	M1099K	probably benign	Het
Mzb1	A	T	18: 35,647,922	H104Q	probably benign	Het
Nfatc2	A	G	2: 168,571,264	L167P	probably benign	Het
Numa1	A	T	7: 102,000,910	S1283C	probably benign	Het
Nup98	T	G	7: 102,191,900		probably null	Het
Olfr1342	T	C	4: 118,690,018	I145V	probably benign	Het
Olfr476	T	C	7: 107,967,667	L90P	probably benign	Het
Pkhd1l1	A	G	15: 44,522,695	T1243A	possibly damaging	Het
Ptpro	C	T	6: 137,454,598	R1152W	probably damaging	Het
Ptprt	T	C	2: 161,547,364	T1270A	probably damaging	Het
Pwwp2b	A	C	7: 139,256,133	T497P	probably damaging	Het
Rab44	T	A	17: 29,139,444	V202E		Het
Rbfox1	C	T	16: 7,294,083	T191I	probably damaging	Het
Rufy4	A	G	1: 74,133,015	K299R	probably damaging	Het
Snip1	T	A	4: 125,072,919	S381T	probably damaging	Het
Spen	T	C	4: 141,472,650	I2889V	possibly damaging	Het
St3gal3	T	A	4: 117,957,442	D218V		Het
Sun1	A	G	5: 139,226,687	T70A	unknown	Het
Tbc1d23	C	T	16: 57,170,382	V678M	probably damaging	Het
Tdh	T	A	14: 63,495,757	Y195F	probably damaging	Het
Tescl	C	T	7: 24,333,861	R13H	possibly damaging	Het
Tfap2c	T	A	2: 172,557,357	M508K	probably benign	Het
Trappc4	A	G	9: 44,405,290	M136T	probably benign	Het
Tyk2	A	G	9: 21,105,054	C1207R	probably damaging	Het
Ugt2b36	T	C	5: 87,081,539	Y355C	probably damaging	Het
Vmn1r119	T	A	7: 21,011,647	H270L	probably benign	Het
Vmn2r20	G	A	6: 123,386,115	P570L	probably damaging	Het
Wnk1	A	C	6: 120,002,273	Y284*	probably null	Het
Yars2	C	T	16: 16,303,318	A112V	probably damaging	Het
Zer1	T	C	2: 30,105,012	N470S	probably damaging	Het
Zfp879	A	C	11: 50,832,681	V516G	possibly damaging	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CACTGATTGGGTTCCTCGTG -3'
(R):5'- AATGACGGTGTCAACGTCTGC -3'

Sequencing Primer
(F):5'- CGTGTGGATGACGTTGTGACC -3'
(R):5'- CTGACTCTCAGGAAGTGCC -3'

Posted On

2019-06-26