Incidental Mutation 'R7218:Filip1'
ID561604
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Namefilamin A interacting protein 1
Synonyms5730485H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location79815051-80012851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79818074 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1088 (S1088G)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
Predicted Effect probably benign
Transcript: ENSMUST00000093811
AA Change: S1088G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: S1088G

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
R0101:Filip1 UTSW 9 79819528 missense probably benign 0.04
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79820289 missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R1983:Filip1 UTSW 9 79860092 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6385:Filip1 UTSW 9 79820531 missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79815839 missense probably damaging 1.00
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTGATTGGGTTCCTCGTG -3'
(R):5'- AATGACGGTGTCAACGTCTGC -3'

Sequencing Primer
(F):5'- CGTGTGGATGACGTTGTGACC -3'
(R):5'- CTGACTCTCAGGAAGTGCC -3'
Posted On2019-06-26