Incidental Mutation 'R7218:Actn2'
ID561610
Institutional Source Beutler Lab
Gene Symbol Actn2
Ensembl Gene ENSMUSG00000052374
Gene Nameactinin alpha 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location12269426-12340760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12278913 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 574 (S574P)
Ref Sequence ENSEMBL: ENSMUSP00000067708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064204] [ENSMUST00000168193] [ENSMUST00000221162]
Predicted Effect probably benign
Transcript: ENSMUST00000064204
AA Change: S574P

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067708
Gene: ENSMUSG00000052374
AA Change: S574P

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 2e-16 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168193
AA Change: S574P

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129609
Gene: ENSMUSG00000052374
AA Change: S574P

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 7e-18 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221162
AA Change: S80P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a muscle-specific, alpha actinin isoform that is expressed in both skeletal and cardiac muscles. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Actn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Actn2 APN 13 12310910 missense possibly damaging 0.50
IGL01909:Actn2 APN 13 12309593 critical splice donor site probably null
IGL01994:Actn2 APN 13 12290677 missense probably benign 0.26
IGL02118:Actn2 APN 13 12276547 intron probably benign
IGL02480:Actn2 APN 13 12276478 missense probably benign 0.02
IGL02827:Actn2 APN 13 12275199 missense probably damaging 1.00
IGL03110:Actn2 APN 13 12309607 missense probably benign 0.02
R0044:Actn2 UTSW 13 12275127 missense possibly damaging 0.51
R0512:Actn2 UTSW 13 12277415 missense probably damaging 1.00
R1623:Actn2 UTSW 13 12340439 missense probably benign
R1983:Actn2 UTSW 13 12278810 missense probably benign 0.00
R1989:Actn2 UTSW 13 12340395 missense probably benign 0.38
R2148:Actn2 UTSW 13 12300949 missense probably damaging 0.99
R2196:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R2254:Actn2 UTSW 13 12296479 missense probably benign 0.20
R2850:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R4391:Actn2 UTSW 13 12290748 missense probably damaging 0.99
R4396:Actn2 UTSW 13 12310879 missense probably damaging 1.00
R4758:Actn2 UTSW 13 12288586 nonsense probably null
R5068:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5069:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5070:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5228:Actn2 UTSW 13 12288659 critical splice acceptor site probably null
R5382:Actn2 UTSW 13 12308951 missense probably benign 0.37
R5408:Actn2 UTSW 13 12270795 missense probably benign 0.41
R5975:Actn2 UTSW 13 12340497 missense probably benign 0.43
R6189:Actn2 UTSW 13 12276440 missense probably damaging 1.00
R6226:Actn2 UTSW 13 12278967 missense probably benign
R6498:Actn2 UTSW 13 12276473 missense probably damaging 1.00
R7094:Actn2 UTSW 13 12309657 missense probably damaging 1.00
R7164:Actn2 UTSW 13 12278961 missense probably damaging 1.00
R7260:Actn2 UTSW 13 12276490 missense probably benign 0.00
R7768:Actn2 UTSW 13 12282594 missense possibly damaging 0.72
R7896:Actn2 UTSW 13 12294317 missense possibly damaging 0.76
R8141:Actn2 UTSW 13 12288630 missense probably damaging 1.00
X0018:Actn2 UTSW 13 12269645 missense probably damaging 1.00
Z1177:Actn2 UTSW 13 12288562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGATTAGGTCATCCTCC -3'
(R):5'- TGCCTTGTGGGTACAAAGTC -3'

Sequencing Primer
(F):5'- GGATTAGGTCATCCTCCATCCCAC -3'
(R):5'- TTGTGATCCCAGACTGGAAC -3'
Posted On2019-06-26