Incidental Mutation 'R7218:Myo7b'
ID 561625
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 045290-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7218 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32114054 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1099 (M1099K)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: M1099K

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: M1099K

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 46,043,977 (GRCm39) T94A unknown Het
1700025G04Rik T C 1: 151,791,259 (GRCm39) R101G probably damaging Het
6430548M08Rik T A 8: 120,872,322 (GRCm39) S83R probably damaging Het
Actn2 A G 13: 12,293,799 (GRCm39) S574P probably benign Het
Ank A T 15: 27,544,407 (GRCm39) Y56F probably damaging Het
Ano7 A G 1: 93,308,191 (GRCm39) D74G probably benign Het
Apaf1 T A 10: 90,872,864 (GRCm39) T738S probably damaging Het
Apcs A T 1: 172,722,231 (GRCm39) D38E possibly damaging Het
Asap1 G A 15: 64,002,099 (GRCm39) T404M probably damaging Het
Atp8a1 T A 5: 67,860,324 (GRCm39) D717V Het
Baiap2l1 A G 5: 144,212,687 (GRCm39) S443P probably benign Het
Bmal1 A T 7: 112,886,390 (GRCm39) H149L probably damaging Het
Brix1 T C 15: 10,483,378 (GRCm39) probably null Het
C1qtnf6 T C 15: 78,411,574 (GRCm39) E34G probably benign Het
Chil3 A C 3: 106,067,853 (GRCm39) probably null Het
Chmp4c T A 3: 10,432,198 (GRCm39) L36Q probably damaging Het
Chrna2 T A 14: 66,381,320 (GRCm39) probably null Het
Clec1a C T 6: 129,413,918 (GRCm39) C57Y probably damaging Het
Clec7a G T 6: 129,445,885 (GRCm39) T95K probably damaging Het
Csf1r C A 18: 61,263,396 (GRCm39) S926R probably damaging Het
Dnajc9 A G 14: 20,438,507 (GRCm39) I61T probably benign Het
Extl1 T G 4: 134,087,080 (GRCm39) S493R probably benign Het
Fance A G 17: 28,545,148 (GRCm39) D143G probably benign Het
Fcho2 C T 13: 98,890,121 (GRCm39) probably null Het
Filip1 T C 9: 79,725,356 (GRCm39) S1088G probably benign Het
Gnat1 A C 9: 107,553,184 (GRCm39) M319R possibly damaging Het
Gpr132 A T 12: 112,816,049 (GRCm39) V259E probably damaging Het
Gprc5d T A 6: 135,093,452 (GRCm39) M152L probably benign Het
Hif3a C T 7: 16,784,513 (GRCm39) R244H probably damaging Het
Hivep3 T C 4: 119,952,649 (GRCm39) S322P possibly damaging Het
Il33 T A 19: 29,936,325 (GRCm39) F229I probably damaging Het
Il4ra A G 7: 125,174,950 (GRCm39) D386G probably benign Het
Ino80 G T 2: 119,288,608 (GRCm39) H33N probably benign Het
Ip6k1 A G 9: 107,922,781 (GRCm39) D228G unknown Het
Mamdc2 C T 19: 23,424,974 (GRCm39) A40T probably benign Het
Meis3 T C 7: 15,918,626 (GRCm39) V357A probably benign Het
Mycbp2 T C 14: 103,371,282 (GRCm39) T4199A probably benign Het
Mzb1 A T 18: 35,780,975 (GRCm39) H104Q probably benign Het
Nfatc2 A G 2: 168,413,184 (GRCm39) L167P probably benign Het
Numa1 A T 7: 101,650,117 (GRCm39) S1283C probably benign Het
Nup98 T G 7: 101,841,107 (GRCm39) probably null Het
Or13p4 T C 4: 118,547,215 (GRCm39) I145V probably benign Het
Or5p55 T C 7: 107,566,874 (GRCm39) L90P probably benign Het
Pkhd1l1 A G 15: 44,386,091 (GRCm39) T1243A possibly damaging Het
Pramel39-ps C A 5: 94,451,113 (GRCm39) V338F probably benign Het
Ptpro C T 6: 137,431,596 (GRCm39) R1152W probably damaging Het
Ptprt T C 2: 161,389,284 (GRCm39) T1270A probably damaging Het
Pwwp2b A C 7: 138,836,049 (GRCm39) T497P probably damaging Het
Rab44 T A 17: 29,358,418 (GRCm39) V202E Het
Rbfox1 C T 16: 7,111,947 (GRCm39) T191I probably damaging Het
Rufy4 A G 1: 74,172,174 (GRCm39) K299R probably damaging Het
Snip1 T A 4: 124,966,712 (GRCm39) S381T probably damaging Het
Spen T C 4: 141,199,961 (GRCm39) I2889V possibly damaging Het
Spopfm2 A T 3: 94,082,856 (GRCm39) H318Q possibly damaging Het
St3gal3 T A 4: 117,814,639 (GRCm39) D218V Het
Sun1 A G 5: 139,212,442 (GRCm39) T70A unknown Het
Tbc1d23 C T 16: 56,990,745 (GRCm39) V678M probably damaging Het
Tdh T A 14: 63,733,206 (GRCm39) Y195F probably damaging Het
Tescl C T 7: 24,033,286 (GRCm39) R13H possibly damaging Het
Tfap2c T A 2: 172,399,277 (GRCm39) M508K probably benign Het
Trappc4 A G 9: 44,316,587 (GRCm39) M136T probably benign Het
Tyk2 A G 9: 21,016,350 (GRCm39) C1207R probably damaging Het
Ugt2b36 T C 5: 87,229,398 (GRCm39) Y355C probably damaging Het
Vmn1r119 T A 7: 20,745,572 (GRCm39) H270L probably benign Het
Vmn2r20 G A 6: 123,363,074 (GRCm39) P570L probably damaging Het
Wnk1 A C 6: 119,979,234 (GRCm39) Y284* probably null Het
Yars2 C T 16: 16,121,182 (GRCm39) A112V probably damaging Het
Zer1 T C 2: 29,995,024 (GRCm39) N470S probably damaging Het
Zfp747l1 A T 7: 126,983,852 (GRCm39) S417T probably benign Het
Zfp879 A C 11: 50,723,508 (GRCm39) V516G possibly damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACAGCAGCTAGGCCAAG -3'
(R):5'- TCAGTGTCAGATTGGTACAGAG -3'

Sequencing Primer
(F):5'- AGACCTAGTCTCCAGGCTCATG -3'
(R):5'- ACAGAGCTCTTGGCCATTG -3'
Posted On 2019-06-26