Mutagenetix > Incidental Mutation

Incidental Mutation 'R7218:Csf1r'

561627

Institutional Source

Beutler Lab

Gene Symbol

Csf1r

Ensembl Gene

ENSMUSG00000024621

Gene Name

colony stimulating factor 1 receptor

Synonyms

Fms, Fim-2, CD115, M-CSFR, CSF-1R, Csfmr

MMRRC Submission

045290-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.913) question?

Stock #

R7218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61105572-61132149 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 61130324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 926 (S926R)

Ref Sequence

ENSEMBL: ENSMUSP00000025523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000091884] [ENSMUST00000115268]

AlphaFold

P09581

Predicted Effect

probably damaging
Transcript: ENSMUST00000025523
AA Change: S926R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621
AA Change: S926R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	27	102	4.63e-8	SMART
IG	112	196	7.82e-6	SMART
IGc2	215	285	1.36e-5	SMART
IG	308	397	3.2e-2	SMART
IG_like	402	504	1.8e2	SMART
transmembrane domain	513	535	N/A	INTRINSIC
TyrKc	580	908	1.45e-134	SMART
low complexity region	926	954	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000091884

SMART Domains

Protein: ENSMUSP00000089498
Gene: ENSMUSG00000024622

Domain	Start	End	E-Value	Type
HMG	40	110	6.8e-15	SMART
low complexity region	182	194	N/A	INTRINSIC
internal_repeat_1	307	336	1.98e-9	PROSPERO
internal_repeat_1	583	612	1.98e-9	PROSPERO
low complexity region	817	830	N/A	INTRINSIC
low complexity region	966	977	N/A	INTRINSIC
low complexity region	1239	1254	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115268
AA Change: S926R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621
AA Change: S926R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	27	102	4.63e-8	SMART
IG	112	196	7.82e-6	SMART
IGc2	215	285	1.36e-5	SMART
IG	308	397	3.2e-2	SMART
IG_like	402	504	1.8e2	SMART
transmembrane domain	513	535	N/A	INTRINSIC
TyrKc	580	908	1.45e-134	SMART
low complexity region	926	954	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skeletal, sensory, and reproductive abnormalities associated with severe deficiencies in osteoclasts, macrophages, and brain microglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	T	C	17: 45,733,051	T94A	unknown	Het
1700025G04Rik	T	C	1: 151,915,508	R101G	probably damaging	Het
6430548M08Rik	T	A	8: 120,145,583	S83R	probably damaging	Het
9130019O22Rik	A	T	7: 127,384,680	S417T	probably benign	Het
A430089I19Rik	C	A	5: 94,303,254	V338F	probably benign	Het
Actn2	A	G	13: 12,278,913	S574P	probably benign	Het
Ank	A	T	15: 27,544,321	Y56F	probably damaging	Het
Ano7	A	G	1: 93,380,469	D74G	probably benign	Het
Apaf1	T	A	10: 91,037,002	T738S	probably damaging	Het
Apcs	A	T	1: 172,894,664	D38E	possibly damaging	Het
Arntl	A	T	7: 113,287,183	H149L	probably damaging	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Atp8a1	T	A	5: 67,702,981	D717V		Het
Baiap2l1	A	G	5: 144,275,877	S443P	probably benign	Het
Brix1	T	C	15: 10,483,292		probably null	Het
C1qtnf6	T	C	15: 78,527,374	E34G	probably benign	Het
Chil3	A	C	3: 106,160,537		probably null	Het
Chmp4c	T	A	3: 10,367,138	L36Q	probably damaging	Het
Chrna2	T	A	14: 66,143,871		probably null	Het
Clec1a	C	T	6: 129,436,955	C57Y	probably damaging	Het
Clec7a	G	T	6: 129,468,922	T95K	probably damaging	Het
Dnajc9	A	G	14: 20,388,439	I61T	probably benign	Het
Extl1	T	G	4: 134,359,769	S493R	probably benign	Het
Fance	A	G	17: 28,326,174	D143G	probably benign	Het
Fcho2	C	T	13: 98,753,613		probably null	Het
Filip1	T	C	9: 79,818,074	S1088G	probably benign	Het
Gm10696	A	T	3: 94,175,549	H318Q	possibly damaging	Het
Gnat1	A	C	9: 107,675,985	M319R	possibly damaging	Het
Gpr132	A	T	12: 112,852,429	V259E	probably damaging	Het
Gprc5d	T	A	6: 135,116,454	M152L	probably benign	Het
Hif3a	C	T	7: 17,050,588	R244H	probably damaging	Het
Hivep3	T	C	4: 120,095,452	S322P	possibly damaging	Het
Il33	T	A	19: 29,958,925	F229I	probably damaging	Het
Il4ra	A	G	7: 125,575,778	D386G	probably benign	Het
Ino80	G	T	2: 119,458,127	H33N	probably benign	Het
Ip6k1	A	G	9: 108,045,582	D228G	unknown	Het
Mamdc2	C	T	19: 23,447,610	A40T	probably benign	Het
Meis3	T	C	7: 16,184,701	V357A	probably benign	Het
Mycbp2	T	C	14: 103,133,846	T4199A	probably benign	Het
Myo7b	A	T	18: 31,981,001	M1099K	probably benign	Het
Mzb1	A	T	18: 35,647,922	H104Q	probably benign	Het
Nfatc2	A	G	2: 168,571,264	L167P	probably benign	Het
Numa1	A	T	7: 102,000,910	S1283C	probably benign	Het
Nup98	T	G	7: 102,191,900		probably null	Het
Olfr1342	T	C	4: 118,690,018	I145V	probably benign	Het
Olfr476	T	C	7: 107,967,667	L90P	probably benign	Het
Pkhd1l1	A	G	15: 44,522,695	T1243A	possibly damaging	Het
Ptpro	C	T	6: 137,454,598	R1152W	probably damaging	Het
Ptprt	T	C	2: 161,547,364	T1270A	probably damaging	Het
Pwwp2b	A	C	7: 139,256,133	T497P	probably damaging	Het
Rab44	T	A	17: 29,139,444	V202E		Het
Rbfox1	C	T	16: 7,294,083	T191I	probably damaging	Het
Rufy4	A	G	1: 74,133,015	K299R	probably damaging	Het
Snip1	T	A	4: 125,072,919	S381T	probably damaging	Het
Spen	T	C	4: 141,472,650	I2889V	possibly damaging	Het
St3gal3	T	A	4: 117,957,442	D218V		Het
Sun1	A	G	5: 139,226,687	T70A	unknown	Het
Tbc1d23	C	T	16: 57,170,382	V678M	probably damaging	Het
Tdh	T	A	14: 63,495,757	Y195F	probably damaging	Het
Tescl	C	T	7: 24,333,861	R13H	possibly damaging	Het
Tfap2c	T	A	2: 172,557,357	M508K	probably benign	Het
Trappc4	A	G	9: 44,405,290	M136T	probably benign	Het
Tyk2	A	G	9: 21,105,054	C1207R	probably damaging	Het
Ugt2b36	T	C	5: 87,081,539	Y355C	probably damaging	Het
Vmn1r119	T	A	7: 21,011,647	H270L	probably benign	Het
Vmn2r20	G	A	6: 123,386,115	P570L	probably damaging	Het
Wnk1	A	C	6: 120,002,273	Y284*	probably null	Het
Yars2	C	T	16: 16,303,318	A112V	probably damaging	Het
Zer1	T	C	2: 30,105,012	N470S	probably damaging	Het
Zfp879	A	C	11: 50,832,681	V516G	possibly damaging	Het

Other mutations in Csf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01403:Csf1r	APN	18	61114825	missense	probably benign	0.08
IGL01603:Csf1r	APN	18	61129301	missense	probably damaging	1.00
IGL02377:Csf1r	APN	18	61124468	splice site	probably benign
IGL03000:Csf1r	APN	18	61109652	missense	probably damaging	0.97
IGL03011:Csf1r	APN	18	61110401	missense	probably benign	0.00
IGL03132:Csf1r	APN	18	61128099	missense	probably benign	0.03
IGL03189:Csf1r	APN	18	61105986	missense	probably benign	0.05
IGL03224:Csf1r	APN	18	61112062	missense	probably damaging	0.96
IGL03351:Csf1r	APN	18	61117108	nonsense	probably null
ANU74:Csf1r	UTSW	18	61117391	missense	probably benign	0.09
R1245:Csf1r	UTSW	18	61114812	missense	probably benign
R1363:Csf1r	UTSW	18	61124845	missense	possibly damaging	0.95
R1651:Csf1r	UTSW	18	61110401	missense	possibly damaging	0.64
R1785:Csf1r	UTSW	18	61129077	missense	probably damaging	0.98
R1786:Csf1r	UTSW	18	61129077	missense	probably damaging	0.98
R1902:Csf1r	UTSW	18	61130141	missense	probably damaging	0.99
R1968:Csf1r	UTSW	18	61112795	missense	probably benign	0.00
R2177:Csf1r	UTSW	18	61114943	splice site	probably benign
R3743:Csf1r	UTSW	18	61114774	missense	probably benign	0.01
R3809:Csf1r	UTSW	18	61112764	missense	probably benign	0.22
R4374:Csf1r	UTSW	18	61119006	missense	probably damaging	0.99
R4683:Csf1r	UTSW	18	61124911	missense	probably damaging	1.00
R4973:Csf1r	UTSW	18	61129047	missense	probably damaging	1.00
R5080:Csf1r	UTSW	18	61124301	missense	probably damaging	1.00
R5314:Csf1r	UTSW	18	61129724	missense	probably damaging	1.00
R5936:Csf1r	UTSW	18	61125808	missense	probably damaging	1.00
R6015:Csf1r	UTSW	18	61109712	missense	possibly damaging	0.50
R6227:Csf1r	UTSW	18	61125828	nonsense	probably null
R6505:Csf1r	UTSW	18	61129733	missense	probably damaging	1.00
R6602:Csf1r	UTSW	18	61110425	missense	possibly damaging	0.81
R6811:Csf1r	UTSW	18	61119053	missense	probably damaging	1.00
R6813:Csf1r	UTSW	18	61112734	missense	probably benign
R7480:Csf1r	UTSW	18	61117538	missense	probably benign	0.06
R7752:Csf1r	UTSW	18	61110296	missense	probably damaging	1.00
R7762:Csf1r	UTSW	18	61110500	missense	probably benign	0.01
R7901:Csf1r	UTSW	18	61110296	missense	probably damaging	1.00
R7953:Csf1r	UTSW	18	61124875	missense	probably damaging	1.00
R7986:Csf1r	UTSW	18	61114832	missense	probably benign	0.00
R8012:Csf1r	UTSW	18	61117064	missense	possibly damaging	0.86
R8043:Csf1r	UTSW	18	61124875	missense	probably damaging	1.00
R8296:Csf1r	UTSW	18	61117678	missense	probably damaging	1.00
R8355:Csf1r	UTSW	18	61128150	missense	probably damaging	1.00
R8371:Csf1r	UTSW	18	61117591	missense	probably benign	0.26
R8421:Csf1r	UTSW	18	61127894	missense	probably damaging	1.00
R8493:Csf1r	UTSW	18	61114882	missense	probably damaging	0.98
R8726:Csf1r	UTSW	18	61117656	missense	probably benign	0.17
R8786:Csf1r	UTSW	18	61114870	missense	probably damaging	0.98
R9262:Csf1r	UTSW	18	61110334	missense	probably benign	0.00
R9555:Csf1r	UTSW	18	61110401	missense	possibly damaging	0.64
R9627:Csf1r	UTSW	18	61127900	missense	probably damaging	1.00
R9778:Csf1r	UTSW	18	61127885	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGTTTCCAGATACAGCATCATGC -3'
(R):5'- GCGAAGTCCATATGTTCTCCC -3'

Sequencing Primer
(F):5'- TGGAGCCTACCAGAAGACC -3'
(R):5'- GAAGTCCATATGTTCTCCCCATGTC -3'

Posted On

2019-06-26