Incidental Mutation 'R7218:Il33'
ID 561629
Institutional Source Beutler Lab
Gene Symbol Il33
Ensembl Gene ENSMUSG00000024810
Gene Name interleukin 33
Synonyms NF-HEV, Il-33, Il1f11, 9230117N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7218 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 29925114-29960718 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29958925 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 229 (F229I)
Ref Sequence ENSEMBL: ENSMUSP00000025724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025724] [ENSMUST00000120388] [ENSMUST00000177518]
AlphaFold Q8BVZ5
Predicted Effect probably damaging
Transcript: ENSMUST00000025724
AA Change: F229I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025724
Gene: ENSMUSG00000024810
AA Change: F229I

DomainStartEndE-ValueType
Pfam:IL33 5 264 4.6e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120388
AA Change: F229I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113829
Gene: ENSMUSG00000024810
AA Change: F229I

DomainStartEndE-ValueType
Pfam:IL33 5 264 3.4e-129 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177518
AA Change: F212I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135854
Gene: ENSMUSG00000024810
AA Change: F212I

DomainStartEndE-ValueType
Pfam:IL33 5 228 4.1e-115 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Nullizygous mutations lead to altered Type 2 immunity and increased susceptibility to parasite infection. Homozygotes for a null allele show accelerated ovarian functional decline and early reproductive aging due to impaired migration of ovarian macrophages and failed disposal of atretic follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Il33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Il33 APN 19 29952756 missense probably benign 0.00
IGL01531:Il33 APN 19 29951981 missense possibly damaging 0.71
IGL01627:Il33 APN 19 29951990 missense possibly damaging 0.95
IGL02535:Il33 APN 19 29952747 missense probably benign 0.04
lacquer UTSW 19 29951990 missense possibly damaging 0.95
PIT4504001:Il33 UTSW 19 29952739 missense probably benign 0.12
R0548:Il33 UTSW 19 29954647 missense probably benign 0.37
R0557:Il33 UTSW 19 29954636 missense probably damaging 0.98
R1511:Il33 UTSW 19 29955215 missense probably damaging 1.00
R1512:Il33 UTSW 19 29951990 missense possibly damaging 0.95
R1993:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R1994:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R2035:Il33 UTSW 19 29954637 missense probably damaging 0.98
R4779:Il33 UTSW 19 29958911 nonsense probably null
R6429:Il33 UTSW 19 29952000 missense probably benign 0.16
R6498:Il33 UTSW 19 29949737 missense probably benign
R6879:Il33 UTSW 19 29958962 missense probably damaging 0.98
R7571:Il33 UTSW 19 29956941 missense probably damaging 1.00
X0025:Il33 UTSW 19 29954612 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCTCCTCGACTCAGTACA -3'
(R):5'- AGAATGGCTTTCTTTCTCTCTGT -3'

Sequencing Primer
(F):5'- AGTTCAAGCTATAAGTGATCAGTCCC -3'
(R):5'- TCTGTTACCCTTTCTTCAGTTGG -3'
Posted On 2019-06-26