Incidental Mutation 'R7219:Raph1'
ID 561630
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, lamellipodin, 9430025M21Rik, Lpd
MMRRC Submission 045291-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7219 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 60521451-60606263 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60542032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 309 (Y309H)
Ref Sequence ENSEMBL: ENSMUSP00000121023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect probably benign
Transcript: ENSMUST00000027168
AA Change: Y361H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: Y361H

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
AA Change: Y361H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: Y361H

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: Y309H
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: Y309H

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Meta Mutation Damage Score 0.1150 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,508 (GRCm39) S300P unknown Het
Abhd17a T A 10: 80,420,008 (GRCm39) K226* probably null Het
Alkbh7 T A 17: 57,305,508 (GRCm39) H108Q probably damaging Het
Ankrd44 A C 1: 54,806,069 (GRCm39) H112Q probably damaging Het
Capn3 A G 2: 120,333,935 (GRCm39) E790G probably damaging Het
Cd47 C A 16: 49,728,440 (GRCm39) N330K possibly damaging Het
Cd55 A G 1: 130,390,343 (GRCm39) S22P possibly damaging Het
Cdc25a A G 9: 109,718,154 (GRCm39) I373V probably damaging Het
Cfap43 T C 19: 47,779,912 (GRCm39) I514V probably benign Het
Cfap73 A T 5: 120,768,200 (GRCm39) M186K probably benign Het
Chd9 A G 8: 91,728,394 (GRCm39) D1270G unknown Het
Ciita A G 16: 10,330,121 (GRCm39) T802A probably benign Het
Dlgap2 A G 8: 14,793,296 (GRCm39) E430G probably benign Het
Dlx1 C A 2: 71,360,513 (GRCm39) S59* probably null Het
Dnaaf3 T C 7: 4,531,076 (GRCm39) N119S probably damaging Het
Dnah11 T G 12: 118,004,830 (GRCm39) I2164L possibly damaging Het
Dnah11 T C 12: 118,090,624 (GRCm39) K1079R probably benign Het
Dnah12 C T 14: 26,576,837 (GRCm39) T3029I probably damaging Het
Dppa3 A T 6: 122,606,918 (GRCm39) Y136F probably damaging Het
Enox1 T A 14: 77,958,284 (GRCm39) M611K probably benign Het
Fam149a A T 8: 45,803,600 (GRCm39) I378N possibly damaging Het
Farp2 T C 1: 93,488,040 (GRCm39) F89S probably damaging Het
Fbn2 C T 18: 58,186,099 (GRCm39) V1750M probably benign Het
Frs3 A G 17: 48,013,620 (GRCm39) T181A probably damaging Het
Heatr4 T A 12: 84,004,644 (GRCm39) I726F possibly damaging Het
Ighg1 T G 12: 113,290,216 (GRCm39) E375A Het
Ikzf4 G T 10: 128,470,252 (GRCm39) Q476K possibly damaging Het
Kcnh1 G T 1: 192,187,945 (GRCm39) C829F probably benign Het
Krtap19-4 T C 16: 88,681,797 (GRCm39) Y53C unknown Het
Loricrin C A 3: 91,988,705 (GRCm39) G194C unknown Het
Lrp1 A C 10: 127,393,097 (GRCm39) D2720E probably benign Het
Lrp4 A G 2: 91,322,368 (GRCm39) Y1068C probably damaging Het
Mbnl1 A G 3: 60,511,244 (GRCm39) N67D probably benign Het
Mrpl21 A G 19: 3,336,998 (GRCm39) E123G probably benign Het
Mst1 A T 9: 107,958,485 (GRCm39) D65V probably damaging Het
Myo15b T A 11: 115,767,921 (GRCm39) probably null Het
Myo5a A G 9: 75,028,052 (GRCm39) Y79C probably damaging Het
Oas1c A T 5: 120,940,957 (GRCm39) W279R probably damaging Het
Or4f4-ps1 A T 2: 111,330,532 (GRCm39) M312L probably benign Het
Or4k77 A T 2: 111,199,882 (GRCm39) I302L probably benign Het
Or51f5 A G 7: 102,430,913 (GRCm39) I77V probably benign Het
Pcdh9 C T 14: 93,253,216 (GRCm39) G1149D possibly damaging Het
Pcid2 G A 8: 13,129,907 (GRCm39) T283I probably benign Het
Pdhx A G 2: 102,858,760 (GRCm39) V348A probably benign Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Psmb3 T A 11: 97,602,023 (GRCm39) M131K probably null Het
Rasgrf1 A G 9: 89,866,341 (GRCm39) N593S probably damaging Het
Rbm38 A C 2: 172,863,990 (GRCm39) E53A possibly damaging Het
Rufy3 A G 5: 88,797,715 (GRCm39) T631A probably benign Het
Sbno1 A T 5: 124,543,722 (GRCm39) D272E probably benign Het
Scamp1 T A 13: 94,361,415 (GRCm39) Y207F probably damaging Het
Scn8a T A 15: 100,866,984 (GRCm39) S263R probably damaging Het
Setbp1 T G 18: 78,798,960 (GRCm39) T1407P probably damaging Het
Skor2 T C 18: 76,948,096 (GRCm39) L606P possibly damaging Het
Slc35f6 A G 5: 30,814,796 (GRCm39) N241S probably benign Het
Slc36a2 T G 11: 55,059,744 (GRCm39) D247A probably benign Het
Smim10l1 T A 6: 133,084,895 (GRCm39) F87L unknown Het
Son T C 16: 91,461,889 (GRCm39) S2265P unknown Het
Spta1 A G 1: 174,050,203 (GRCm39) N1748D probably damaging Het
Sptbn2 A G 19: 4,774,201 (GRCm39) D84G probably damaging Het
Tasor2 T A 13: 3,640,521 (GRCm39) L205F probably damaging Het
Tbc1d24 G A 17: 24,404,266 (GRCm39) R293C probably damaging Het
Tex15 A G 8: 34,036,268 (GRCm39) T65A probably benign Het
Thyn1 A G 9: 26,916,506 (GRCm39) Y97C probably damaging Het
Tmem64 T C 4: 15,266,700 (GRCm39) L250P probably damaging Het
Tnfrsf9 A T 4: 151,019,991 (GRCm39) K217N probably damaging Het
Tnxb A G 17: 34,898,039 (GRCm39) T896A probably benign Het
Trpm1 T A 7: 63,854,333 (GRCm39) I285N possibly damaging Het
Try5 T A 6: 41,288,637 (GRCm39) D194V probably damaging Het
U2surp G A 9: 95,372,215 (GRCm39) R316* probably null Het
Ubr2 G T 17: 47,246,360 (GRCm39) S1618* probably null Het
Ugp2 T C 11: 21,273,271 (GRCm39) I449M probably damaging Het
Umodl1 A G 17: 31,201,236 (GRCm39) probably null Het
Vmn2r31 C T 7: 7,390,105 (GRCm39) V538I probably benign Het
Vmn2r31 A T 7: 7,397,397 (GRCm39) M287K probably damaging Het
Wwc2 A G 8: 48,311,919 (GRCm39) V748A unknown Het
Zfp800 A C 6: 28,243,662 (GRCm39) H434Q probably benign Het
Zfp869 A G 8: 70,159,356 (GRCm39) C406R probably damaging Het
Zhx1 A G 15: 57,917,733 (GRCm39) V171A probably benign Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60,565,106 (GRCm39) missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60,542,022 (GRCm39) missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0227:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.00
R0387:Raph1 UTSW 1 60,549,655 (GRCm39) intron probably benign
R0607:Raph1 UTSW 1 60,565,028 (GRCm39) missense probably damaging 1.00
R1740:Raph1 UTSW 1 60,558,183 (GRCm39) nonsense probably null
R2274:Raph1 UTSW 1 60,537,659 (GRCm39) missense probably damaging 1.00
R3108:Raph1 UTSW 1 60,532,545 (GRCm39) missense probably benign 0.01
R3977:Raph1 UTSW 1 60,537,682 (GRCm39) missense probably benign 0.39
R4260:Raph1 UTSW 1 60,542,124 (GRCm39) missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60,542,028 (GRCm39) missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60,542,160 (GRCm39) unclassified probably benign
R4782:Raph1 UTSW 1 60,528,273 (GRCm39) missense probably damaging 1.00
R5027:Raph1 UTSW 1 60,535,436 (GRCm39) missense probably damaging 1.00
R5037:Raph1 UTSW 1 60,535,381 (GRCm39) splice site probably null
R5106:Raph1 UTSW 1 60,572,459 (GRCm39) missense probably damaging 1.00
R5506:Raph1 UTSW 1 60,532,657 (GRCm39) intron probably benign
R5510:Raph1 UTSW 1 60,562,105 (GRCm39) unclassified probably benign
R5587:Raph1 UTSW 1 60,537,632 (GRCm39) missense probably damaging 1.00
R5591:Raph1 UTSW 1 60,540,905 (GRCm39) unclassified probably benign
R5619:Raph1 UTSW 1 60,529,414 (GRCm39) intron probably benign
R5776:Raph1 UTSW 1 60,529,315 (GRCm39) intron probably benign
R5802:Raph1 UTSW 1 60,527,832 (GRCm39) missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60,564,879 (GRCm39) missense probably damaging 0.97
R7122:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.10
R7251:Raph1 UTSW 1 60,529,027 (GRCm39) missense unknown
R7254:Raph1 UTSW 1 60,538,767 (GRCm39) missense unknown
R7732:Raph1 UTSW 1 60,572,447 (GRCm39) missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60,565,148 (GRCm39) missense probably benign 0.00
R7986:Raph1 UTSW 1 60,535,445 (GRCm39) missense
R8167:Raph1 UTSW 1 60,529,270 (GRCm39) missense unknown
R8168:Raph1 UTSW 1 60,538,779 (GRCm39) missense unknown
R8399:Raph1 UTSW 1 60,528,477 (GRCm39) missense unknown
R9036:Raph1 UTSW 1 60,542,124 (GRCm39) missense unknown
R9146:Raph1 UTSW 1 60,558,137 (GRCm39) critical splice donor site probably null
R9338:Raph1 UTSW 1 60,529,300 (GRCm39) missense unknown
R9381:Raph1 UTSW 1 60,540,959 (GRCm39) missense unknown
R9383:Raph1 UTSW 1 60,564,829 (GRCm39) missense unknown
R9399:Raph1 UTSW 1 60,565,154 (GRCm39) missense probably benign
R9454:Raph1 UTSW 1 60,528,753 (GRCm39) missense unknown
R9561:Raph1 UTSW 1 60,564,887 (GRCm39) missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
RF022:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TCAAAGAACTCTCCAGATAGACTAG -3'
(R):5'- ACCTGTAGTAGTAGTGTCAGAGTAG -3'

Sequencing Primer
(F):5'- GCCAGATTTTAAAAAGATAAGGTGAC -3'
(R):5'- GTCCACATGTCTGATGAC -3'
Posted On 2019-06-26