Incidental Mutation 'R7219:Tmem64'
ID561644
Institutional Source Beutler Lab
Gene Symbol Tmem64
Ensembl Gene ENSMUSG00000043252
Gene Nametransmembrane protein 64
Synonyms9630015D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7219 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location15265831-15286753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15266700 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 250 (L250P)
Ref Sequence ENSEMBL: ENSMUSP00000055892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062684]
Predicted Effect probably damaging
Transcript: ENSMUST00000062684
AA Change: L250P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055892
Gene: ENSMUSG00000043252
AA Change: L250P

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 87 104 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
Pfam:SNARE_assoc 173 296 2.2e-21 PFAM
transmembrane domain 309 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (77/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired osteoclast differentiation, enhanced osteoblast differentiation and increased bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,644 S300P unknown Het
Abhd17a T A 10: 80,584,174 K226* probably null Het
Alkbh7 T A 17: 56,998,508 H108Q probably damaging Het
Ankrd44 A C 1: 54,766,910 H112Q probably damaging Het
Capn3 A G 2: 120,503,454 E790G probably damaging Het
Cd47 C A 16: 49,908,077 N330K possibly damaging Het
Cd55 A G 1: 130,462,606 S22P possibly damaging Het
Cdc25a A G 9: 109,889,086 I373V probably damaging Het
Cfap43 T C 19: 47,791,473 I514V probably benign Het
Cfap73 A T 5: 120,630,135 M186K probably benign Het
Chd9 A G 8: 91,001,766 D1270G unknown Het
Ciita A G 16: 10,512,257 T802A probably benign Het
Dlgap2 A G 8: 14,743,296 E430G probably benign Het
Dlx1 C A 2: 71,530,169 S59* probably null Het
Dnaaf3 T C 7: 4,528,077 N119S probably damaging Het
Dnah11 T G 12: 118,041,095 I2164L possibly damaging Het
Dnah11 T C 12: 118,126,889 K1079R probably benign Het
Dnah12 C T 14: 26,854,880 T3029I probably damaging Het
Dppa3 A T 6: 122,629,959 Y136F probably damaging Het
Enox1 T A 14: 77,720,844 M611K probably benign Het
Fam149a A T 8: 45,350,563 I378N possibly damaging Het
Fam208b T A 13: 3,590,521 L205F probably damaging Het
Farp2 T C 1: 93,560,318 F89S probably damaging Het
Fbn2 C T 18: 58,053,027 V1750M probably benign Het
Frs3 A G 17: 47,702,695 T181A probably damaging Het
Heatr4 T A 12: 83,957,870 I726F possibly damaging Het
Ighg1 T G 12: 113,326,596 E375A Het
Ikzf4 G T 10: 128,634,383 Q476K possibly damaging Het
Kcnh1 G T 1: 192,505,637 C829F probably benign Het
Krtap19-4 T C 16: 88,884,909 Y53C unknown Het
Lor C A 3: 92,081,398 G194C unknown Het
Lrp1 A C 10: 127,557,228 D2720E probably benign Het
Lrp4 A G 2: 91,492,023 Y1068C probably damaging Het
Mbnl1 A G 3: 60,603,823 N67D probably benign Het
Mrpl21 A G 19: 3,286,998 E123G probably benign Het
Mst1 A T 9: 108,081,286 D65V probably damaging Het
Myo15b T A 11: 115,877,095 probably null Het
Myo5a A G 9: 75,120,770 Y79C probably damaging Het
Oas1c A T 5: 120,802,892 W279R probably damaging Het
Olfr1283 A T 2: 111,369,537 I302L probably benign Het
Olfr1291-ps1 A T 2: 111,500,187 M312L probably benign Het
Olfr561 A G 7: 102,781,706 I77V probably benign Het
Pcdh9 C T 14: 93,015,780 G1149D possibly damaging Het
Pcid2 G A 8: 13,079,907 T283I probably benign Het
Pdhx A G 2: 103,028,415 V348A probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmb3 T A 11: 97,711,197 M131K probably null Het
Raph1 A G 1: 60,502,873 Y309H unknown Het
Rasgrf1 A G 9: 89,984,288 N593S probably damaging Het
Rbm38 A C 2: 173,022,197 E53A possibly damaging Het
Rufy3 A G 5: 88,649,856 T631A probably benign Het
Sbno1 A T 5: 124,405,659 D272E probably benign Het
Scamp1 T A 13: 94,224,907 Y207F probably damaging Het
Scn8a T A 15: 100,969,103 S263R probably damaging Het
Setbp1 T G 18: 78,755,745 T1407P probably damaging Het
Skor2 T C 18: 76,860,401 L606P possibly damaging Het
Slc35f6 A G 5: 30,657,452 N241S probably benign Het
Slc36a2 T G 11: 55,168,918 D247A probably benign Het
Smim10l1 T A 6: 133,107,932 F87L unknown Het
Son T C 16: 91,665,001 S2265P unknown Het
Spta1 A G 1: 174,222,637 N1748D probably damaging Het
Sptbn2 A G 19: 4,724,173 D84G probably damaging Het
Tbc1d24 G A 17: 24,185,292 R293C probably damaging Het
Tex15 A G 8: 33,546,240 T65A probably benign Het
Thyn1 A G 9: 27,005,210 Y97C probably damaging Het
Tnfrsf9 A T 4: 150,935,534 K217N probably damaging Het
Tnxb A G 17: 34,679,065 T896A probably benign Het
Trpm1 T A 7: 64,204,585 I285N possibly damaging Het
Try5 T A 6: 41,311,703 D194V probably damaging Het
U2surp G A 9: 95,490,162 R316* probably null Het
Ubr2 G T 17: 46,935,434 S1618* probably null Het
Ugp2 T C 11: 21,323,271 I449M probably damaging Het
Umodl1 A G 17: 30,982,262 probably null Het
Vmn2r31 C T 7: 7,387,106 V538I probably benign Het
Vmn2r31 A T 7: 7,394,398 M287K probably damaging Het
Wwc2 A G 8: 47,858,884 V748A unknown Het
Zfp800 A C 6: 28,243,663 H434Q probably benign Het
Zfp869 A G 8: 69,706,706 C406R probably damaging Het
Zhx1 A G 15: 58,054,337 V171A probably benign Het
Other mutations in Tmem64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tmem64 APN 4 15266694 missense probably damaging 1.00
IGL02407:Tmem64 APN 4 15266584 missense probably damaging 1.00
PIT4151001:Tmem64 UTSW 4 15283159 missense probably damaging 1.00
R0257:Tmem64 UTSW 4 15266343 missense probably damaging 1.00
R0737:Tmem64 UTSW 4 15266717 missense probably damaging 0.98
R2217:Tmem64 UTSW 4 15266658 missense possibly damaging 0.89
R2218:Tmem64 UTSW 4 15266658 missense possibly damaging 0.89
R2571:Tmem64 UTSW 4 15266718 missense probably damaging 1.00
R5133:Tmem64 UTSW 4 15281119 missense probably damaging 1.00
R5707:Tmem64 UTSW 4 15266288 missense probably damaging 0.98
R7498:Tmem64 UTSW 4 15266176 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCGTGCTTAATGTGGCG -3'
(R):5'- TTATCAGGTCTTCCAAGGGGC -3'

Sequencing Primer
(F):5'- ACCTGTACGGCTTCGTGCTAG -3'
(R):5'- CTTCCAAGGGGCTGTGTTATATG -3'
Posted On2019-06-26