Mutagenetix > Incidental Mutation

Incidental Mutation 'R7219:Trpm1'

561658

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7219 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64204585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 285 (I285N)

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206107] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: I285N

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: I285N

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000177102
AA Change: I169N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: I169N

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000205348
AA Change: I285N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

probably benign
Transcript: ENSMUST00000205690

Predicted Effect

probably damaging
Transcript: ENSMUST00000205731
AA Change: I169N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000206049

Predicted Effect

probably benign
Transcript: ENSMUST00000206107

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: I169N

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: I285N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably damaging
Transcript: ENSMUST00000206706
AA Change: I152N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Meta Mutation Damage Score

0.5119

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,849,644	S300P	unknown	Het
Abhd17a	T	A	10: 80,584,174	K226*	probably null	Het
Alkbh7	T	A	17: 56,998,508	H108Q	probably damaging	Het
Ankrd44	A	C	1: 54,766,910	H112Q	probably damaging	Het
Capn3	A	G	2: 120,503,454	E790G	probably damaging	Het
Cd47	C	A	16: 49,908,077	N330K	possibly damaging	Het
Cd55	A	G	1: 130,462,606	S22P	possibly damaging	Het
Cdc25a	A	G	9: 109,889,086	I373V	probably damaging	Het
Cfap43	T	C	19: 47,791,473	I514V	probably benign	Het
Cfap73	A	T	5: 120,630,135	M186K	probably benign	Het
Chd9	A	G	8: 91,001,766	D1270G	unknown	Het
Ciita	A	G	16: 10,512,257	T802A	probably benign	Het
Dlgap2	A	G	8: 14,743,296	E430G	probably benign	Het
Dlx1	C	A	2: 71,530,169	S59*	probably null	Het
Dnaaf3	T	C	7: 4,528,077	N119S	probably damaging	Het
Dnah11	T	G	12: 118,041,095	I2164L	possibly damaging	Het
Dnah11	T	C	12: 118,126,889	K1079R	probably benign	Het
Dnah12	C	T	14: 26,854,880	T3029I	probably damaging	Het
Dppa3	A	T	6: 122,629,959	Y136F	probably damaging	Het
Enox1	T	A	14: 77,720,844	M611K	probably benign	Het
Fam149a	A	T	8: 45,350,563	I378N	possibly damaging	Het
Fam208b	T	A	13: 3,590,521	L205F	probably damaging	Het
Farp2	T	C	1: 93,560,318	F89S	probably damaging	Het
Fbn2	C	T	18: 58,053,027	V1750M	probably benign	Het
Frs3	A	G	17: 47,702,695	T181A	probably damaging	Het
Heatr4	T	A	12: 83,957,870	I726F	possibly damaging	Het
Ighg1	T	G	12: 113,326,596	E375A		Het
Ikzf4	G	T	10: 128,634,383	Q476K	possibly damaging	Het
Kcnh1	G	T	1: 192,505,637	C829F	probably benign	Het
Krtap19-4	T	C	16: 88,884,909	Y53C	unknown	Het
Lor	C	A	3: 92,081,398	G194C	unknown	Het
Lrp1	A	C	10: 127,557,228	D2720E	probably benign	Het
Lrp4	A	G	2: 91,492,023	Y1068C	probably damaging	Het
Mbnl1	A	G	3: 60,603,823	N67D	probably benign	Het
Mrpl21	A	G	19: 3,286,998	E123G	probably benign	Het
Mst1	A	T	9: 108,081,286	D65V	probably damaging	Het
Myo15b	T	A	11: 115,877,095		probably null	Het
Myo5a	A	G	9: 75,120,770	Y79C	probably damaging	Het
Oas1c	A	T	5: 120,802,892	W279R	probably damaging	Het
Olfr1283	A	T	2: 111,369,537	I302L	probably benign	Het
Olfr1291-ps1	A	T	2: 111,500,187	M312L	probably benign	Het
Olfr561	A	G	7: 102,781,706	I77V	probably benign	Het
Pcdh9	C	T	14: 93,015,780	G1149D	possibly damaging	Het
Pcid2	G	A	8: 13,079,907	T283I	probably benign	Het
Pdhx	A	G	2: 103,028,415	V348A	probably benign	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Psmb3	T	A	11: 97,711,197	M131K	probably null	Het
Raph1	A	G	1: 60,502,873	Y309H	unknown	Het
Rasgrf1	A	G	9: 89,984,288	N593S	probably damaging	Het
Rbm38	A	C	2: 173,022,197	E53A	possibly damaging	Het
Rufy3	A	G	5: 88,649,856	T631A	probably benign	Het
Sbno1	A	T	5: 124,405,659	D272E	probably benign	Het
Scamp1	T	A	13: 94,224,907	Y207F	probably damaging	Het
Scn8a	T	A	15: 100,969,103	S263R	probably damaging	Het
Setbp1	T	G	18: 78,755,745	T1407P	probably damaging	Het
Skor2	T	C	18: 76,860,401	L606P	possibly damaging	Het
Slc35f6	A	G	5: 30,657,452	N241S	probably benign	Het
Slc36a2	T	G	11: 55,168,918	D247A	probably benign	Het
Smim10l1	T	A	6: 133,107,932	F87L	unknown	Het
Son	T	C	16: 91,665,001	S2265P	unknown	Het
Spta1	A	G	1: 174,222,637	N1748D	probably damaging	Het
Sptbn2	A	G	19: 4,724,173	D84G	probably damaging	Het
Tbc1d24	G	A	17: 24,185,292	R293C	probably damaging	Het
Tex15	A	G	8: 33,546,240	T65A	probably benign	Het
Thyn1	A	G	9: 27,005,210	Y97C	probably damaging	Het
Tmem64	T	C	4: 15,266,700	L250P	probably damaging	Het
Tnfrsf9	A	T	4: 150,935,534	K217N	probably damaging	Het
Tnxb	A	G	17: 34,679,065	T896A	probably benign	Het
Try5	T	A	6: 41,311,703	D194V	probably damaging	Het
U2surp	G	A	9: 95,490,162	R316*	probably null	Het
Ubr2	G	T	17: 46,935,434	S1618*	probably null	Het
Ugp2	T	C	11: 21,323,271	I449M	probably damaging	Het
Umodl1	A	G	17: 30,982,262		probably null	Het
Vmn2r31	C	T	7: 7,387,106	V538I	probably benign	Het
Vmn2r31	A	T	7: 7,394,398	M287K	probably damaging	Het
Wwc2	A	G	8: 47,858,884	V748A	unknown	Het
Zfp800	A	C	6: 28,243,663	H434Q	probably benign	Het
Zfp869	A	G	8: 69,706,706	C406R	probably damaging	Het
Zhx1	A	G	15: 58,054,337	V171A	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTTTCTGTCAGGTAACAAGAGTC -3'
(R):5'- TAGTGCAAGGGTAAGTCTCAGAC -3'

Sequencing Primer
(F):5'- CTGTCAGGTAACAAGAGTCTATCAG -3'
(R):5'- GTCTCAGACCAAATTGTGAACCTGG -3'

Posted On

2019-06-26