Incidental Mutation 'R7219:Tex15'
ID561661
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Nametestis expressed gene 15
Synonyms2210014E14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R7219 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location33516738-33585582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33546240 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 65 (T65A)
Ref Sequence ENSEMBL: ENSMUSP00000114474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124496] [ENSMUST00000124501] [ENSMUST00000149399]
Predicted Effect probably benign
Transcript: ENSMUST00000124496
AA Change: T65A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: T65A

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
AA Change: T65A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628
AA Change: T65A

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149399
AA Change: T65A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114474
Gene: ENSMUSG00000009628
AA Change: T65A

DomainStartEndE-ValueType
Pfam:DUF3715 89 148 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (77/79)
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,644 S300P unknown Het
Abhd17a T A 10: 80,584,174 K226* probably null Het
Alkbh7 T A 17: 56,998,508 H108Q probably damaging Het
Ankrd44 A C 1: 54,766,910 H112Q probably damaging Het
Capn3 A G 2: 120,503,454 E790G probably damaging Het
Cd47 C A 16: 49,908,077 N330K possibly damaging Het
Cd55 A G 1: 130,462,606 S22P possibly damaging Het
Cdc25a A G 9: 109,889,086 I373V probably damaging Het
Cfap43 T C 19: 47,791,473 I514V probably benign Het
Cfap73 A T 5: 120,630,135 M186K probably benign Het
Chd9 A G 8: 91,001,766 D1270G unknown Het
Ciita A G 16: 10,512,257 T802A probably benign Het
Dlgap2 A G 8: 14,743,296 E430G probably benign Het
Dlx1 C A 2: 71,530,169 S59* probably null Het
Dnaaf3 T C 7: 4,528,077 N119S probably damaging Het
Dnah11 T G 12: 118,041,095 I2164L possibly damaging Het
Dnah11 T C 12: 118,126,889 K1079R probably benign Het
Dnah12 C T 14: 26,854,880 T3029I probably damaging Het
Dppa3 A T 6: 122,629,959 Y136F probably damaging Het
Enox1 T A 14: 77,720,844 M611K probably benign Het
Fam149a A T 8: 45,350,563 I378N possibly damaging Het
Fam208b T A 13: 3,590,521 L205F probably damaging Het
Farp2 T C 1: 93,560,318 F89S probably damaging Het
Fbn2 C T 18: 58,053,027 V1750M probably benign Het
Frs3 A G 17: 47,702,695 T181A probably damaging Het
Heatr4 T A 12: 83,957,870 I726F possibly damaging Het
Ighg1 T G 12: 113,326,596 E375A Het
Ikzf4 G T 10: 128,634,383 Q476K possibly damaging Het
Kcnh1 G T 1: 192,505,637 C829F probably benign Het
Krtap19-4 T C 16: 88,884,909 Y53C unknown Het
Lor C A 3: 92,081,398 G194C unknown Het
Lrp1 A C 10: 127,557,228 D2720E probably benign Het
Lrp4 A G 2: 91,492,023 Y1068C probably damaging Het
Mbnl1 A G 3: 60,603,823 N67D probably benign Het
Mrpl21 A G 19: 3,286,998 E123G probably benign Het
Mst1 A T 9: 108,081,286 D65V probably damaging Het
Myo15b T A 11: 115,877,095 probably null Het
Myo5a A G 9: 75,120,770 Y79C probably damaging Het
Oas1c A T 5: 120,802,892 W279R probably damaging Het
Olfr1283 A T 2: 111,369,537 I302L probably benign Het
Olfr1291-ps1 A T 2: 111,500,187 M312L probably benign Het
Olfr561 A G 7: 102,781,706 I77V probably benign Het
Pcdh9 C T 14: 93,015,780 G1149D possibly damaging Het
Pcid2 G A 8: 13,079,907 T283I probably benign Het
Pdhx A G 2: 103,028,415 V348A probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmb3 T A 11: 97,711,197 M131K probably null Het
Raph1 A G 1: 60,502,873 Y309H unknown Het
Rasgrf1 A G 9: 89,984,288 N593S probably damaging Het
Rbm38 A C 2: 173,022,197 E53A possibly damaging Het
Rufy3 A G 5: 88,649,856 T631A probably benign Het
Sbno1 A T 5: 124,405,659 D272E probably benign Het
Scamp1 T A 13: 94,224,907 Y207F probably damaging Het
Scn8a T A 15: 100,969,103 S263R probably damaging Het
Setbp1 T G 18: 78,755,745 T1407P probably damaging Het
Skor2 T C 18: 76,860,401 L606P possibly damaging Het
Slc35f6 A G 5: 30,657,452 N241S probably benign Het
Slc36a2 T G 11: 55,168,918 D247A probably benign Het
Smim10l1 T A 6: 133,107,932 F87L unknown Het
Son T C 16: 91,665,001 S2265P unknown Het
Spta1 A G 1: 174,222,637 N1748D probably damaging Het
Sptbn2 A G 19: 4,724,173 D84G probably damaging Het
Tbc1d24 G A 17: 24,185,292 R293C probably damaging Het
Thyn1 A G 9: 27,005,210 Y97C probably damaging Het
Tmem64 T C 4: 15,266,700 L250P probably damaging Het
Tnfrsf9 A T 4: 150,935,534 K217N probably damaging Het
Tnxb A G 17: 34,679,065 T896A probably benign Het
Trpm1 T A 7: 64,204,585 I285N possibly damaging Het
Try5 T A 6: 41,311,703 D194V probably damaging Het
U2surp G A 9: 95,490,162 R316* probably null Het
Ubr2 G T 17: 46,935,434 S1618* probably null Het
Ugp2 T C 11: 21,323,271 I449M probably damaging Het
Umodl1 A G 17: 30,982,262 probably null Het
Vmn2r31 C T 7: 7,387,106 V538I probably benign Het
Vmn2r31 A T 7: 7,394,398 M287K probably damaging Het
Wwc2 A G 8: 47,858,884 V748A unknown Het
Zfp800 A C 6: 28,243,663 H434Q probably benign Het
Zfp869 A G 8: 69,706,706 C406R probably damaging Het
Zhx1 A G 15: 58,054,337 V171A probably benign Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
Big_gulp UTSW 8 33581734 missense probably damaging 1.00
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 33571101 missense probably damaging 1.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0842:Tex15 UTSW 8 33571547 missense possibly damaging 0.95
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1639:Tex15 UTSW 8 33570817 missense possibly damaging 0.94
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R4967:Tex15 UTSW 8 33574470 missense probably benign 0.34
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6276:Tex15 UTSW 8 33577189 missense possibly damaging 0.93
R6374:Tex15 UTSW 8 33575912 missense probably damaging 1.00
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
R7059:Tex15 UTSW 8 33574730 missense possibly damaging 0.57
R7069:Tex15 UTSW 8 33570720 missense probably benign
R7072:Tex15 UTSW 8 33575431 missense possibly damaging 0.85
R7212:Tex15 UTSW 8 33570826 nonsense probably null
R7212:Tex15 UTSW 8 33572995 missense probably damaging 1.00
R7216:Tex15 UTSW 8 33572986 missense possibly damaging 0.93
R7313:Tex15 UTSW 8 33574817 missense possibly damaging 0.82
R7315:Tex15 UTSW 8 33581516 missense probably benign 0.01
R7444:Tex15 UTSW 8 33576562 missense possibly damaging 0.92
R7455:Tex15 UTSW 8 33576997 missense possibly damaging 0.91
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGAGGTCCACTTTACAGCG -3'
(R):5'- CGACAGAAGGAAGTTAATTCACATG -3'

Sequencing Primer
(F):5'- GAGGTCCACTTTACAGCGATACAATG -3'
(R):5'- GGAAGTTAATTCACATGACTCCACGG -3'
Posted On2019-06-26