Mutagenetix > Incidental Mutation

Incidental Mutation 'R7219:Myo5a'

561667

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R7219 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75120770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 79 (Y79C)

Ref Sequence

ENSEMBL: ENSMUSP00000117493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

AlphaFold

Q99104

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: Y79C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

probably damaging
Transcript: ENSMUST00000136731
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: Y79C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155282
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: Y79C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,849,644	S300P	unknown	Het
Abhd17a	T	A	10: 80,584,174	K226*	probably null	Het
Alkbh7	T	A	17: 56,998,508	H108Q	probably damaging	Het
Ankrd44	A	C	1: 54,766,910	H112Q	probably damaging	Het
Capn3	A	G	2: 120,503,454	E790G	probably damaging	Het
Cd47	C	A	16: 49,908,077	N330K	possibly damaging	Het
Cd55	A	G	1: 130,462,606	S22P	possibly damaging	Het
Cdc25a	A	G	9: 109,889,086	I373V	probably damaging	Het
Cfap43	T	C	19: 47,791,473	I514V	probably benign	Het
Cfap73	A	T	5: 120,630,135	M186K	probably benign	Het
Chd9	A	G	8: 91,001,766	D1270G	unknown	Het
Ciita	A	G	16: 10,512,257	T802A	probably benign	Het
Dlgap2	A	G	8: 14,743,296	E430G	probably benign	Het
Dlx1	C	A	2: 71,530,169	S59*	probably null	Het
Dnaaf3	T	C	7: 4,528,077	N119S	probably damaging	Het
Dnah11	T	G	12: 118,041,095	I2164L	possibly damaging	Het
Dnah11	T	C	12: 118,126,889	K1079R	probably benign	Het
Dnah12	C	T	14: 26,854,880	T3029I	probably damaging	Het
Dppa3	A	T	6: 122,629,959	Y136F	probably damaging	Het
Enox1	T	A	14: 77,720,844	M611K	probably benign	Het
Fam149a	A	T	8: 45,350,563	I378N	possibly damaging	Het
Fam208b	T	A	13: 3,590,521	L205F	probably damaging	Het
Farp2	T	C	1: 93,560,318	F89S	probably damaging	Het
Fbn2	C	T	18: 58,053,027	V1750M	probably benign	Het
Frs3	A	G	17: 47,702,695	T181A	probably damaging	Het
Heatr4	T	A	12: 83,957,870	I726F	possibly damaging	Het
Ighg1	T	G	12: 113,326,596	E375A		Het
Ikzf4	G	T	10: 128,634,383	Q476K	possibly damaging	Het
Kcnh1	G	T	1: 192,505,637	C829F	probably benign	Het
Krtap19-4	T	C	16: 88,884,909	Y53C	unknown	Het
Lor	C	A	3: 92,081,398	G194C	unknown	Het
Lrp1	A	C	10: 127,557,228	D2720E	probably benign	Het
Lrp4	A	G	2: 91,492,023	Y1068C	probably damaging	Het
Mbnl1	A	G	3: 60,603,823	N67D	probably benign	Het
Mrpl21	A	G	19: 3,286,998	E123G	probably benign	Het
Mst1	A	T	9: 108,081,286	D65V	probably damaging	Het
Myo15b	T	A	11: 115,877,095		probably null	Het
Oas1c	A	T	5: 120,802,892	W279R	probably damaging	Het
Olfr1283	A	T	2: 111,369,537	I302L	probably benign	Het
Olfr1291-ps1	A	T	2: 111,500,187	M312L	probably benign	Het
Olfr561	A	G	7: 102,781,706	I77V	probably benign	Het
Pcdh9	C	T	14: 93,015,780	G1149D	possibly damaging	Het
Pcid2	G	A	8: 13,079,907	T283I	probably benign	Het
Pdhx	A	G	2: 103,028,415	V348A	probably benign	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Psmb3	T	A	11: 97,711,197	M131K	probably null	Het
Raph1	A	G	1: 60,502,873	Y309H	unknown	Het
Rasgrf1	A	G	9: 89,984,288	N593S	probably damaging	Het
Rbm38	A	C	2: 173,022,197	E53A	possibly damaging	Het
Rufy3	A	G	5: 88,649,856	T631A	probably benign	Het
Sbno1	A	T	5: 124,405,659	D272E	probably benign	Het
Scamp1	T	A	13: 94,224,907	Y207F	probably damaging	Het
Scn8a	T	A	15: 100,969,103	S263R	probably damaging	Het
Setbp1	T	G	18: 78,755,745	T1407P	probably damaging	Het
Skor2	T	C	18: 76,860,401	L606P	possibly damaging	Het
Slc35f6	A	G	5: 30,657,452	N241S	probably benign	Het
Slc36a2	T	G	11: 55,168,918	D247A	probably benign	Het
Smim10l1	T	A	6: 133,107,932	F87L	unknown	Het
Son	T	C	16: 91,665,001	S2265P	unknown	Het
Spta1	A	G	1: 174,222,637	N1748D	probably damaging	Het
Sptbn2	A	G	19: 4,724,173	D84G	probably damaging	Het
Tbc1d24	G	A	17: 24,185,292	R293C	probably damaging	Het
Tex15	A	G	8: 33,546,240	T65A	probably benign	Het
Thyn1	A	G	9: 27,005,210	Y97C	probably damaging	Het
Tmem64	T	C	4: 15,266,700	L250P	probably damaging	Het
Tnfrsf9	A	T	4: 150,935,534	K217N	probably damaging	Het
Tnxb	A	G	17: 34,679,065	T896A	probably benign	Het
Trpm1	T	A	7: 64,204,585	I285N	possibly damaging	Het
Try5	T	A	6: 41,311,703	D194V	probably damaging	Het
U2surp	G	A	9: 95,490,162	R316*	probably null	Het
Ubr2	G	T	17: 46,935,434	S1618*	probably null	Het
Ugp2	T	C	11: 21,323,271	I449M	probably damaging	Het
Umodl1	A	G	17: 30,982,262		probably null	Het
Vmn2r31	C	T	7: 7,387,106	V538I	probably benign	Het
Vmn2r31	A	T	7: 7,394,398	M287K	probably damaging	Het
Wwc2	A	G	8: 47,858,884	V748A	unknown	Het
Zfp800	A	C	6: 28,243,663	H434Q	probably benign	Het
Zfp869	A	G	8: 69,706,706	C406R	probably damaging	Het
Zhx1	A	G	15: 58,054,337	V171A	probably benign	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211126	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9040:Myo5a	UTSW	9	75174059	missense	probably benign	0.07
R9092:Myo5a	UTSW	9	75147132	critical splice donor site	probably null
R9249:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9274:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9293:Myo5a	UTSW	9	75180030	missense	probably benign	0.37
R9366:Myo5a	UTSW	9	75217518	missense	probably damaging	0.98
R9410:Myo5a	UTSW	9	75116214	missense	probably damaging	0.98
R9644:Myo5a	UTSW	9	75136349	missense	probably damaging	1.00
R9649:Myo5a	UTSW	9	75192444	missense
R9748:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9766:Myo5a	UTSW	9	75171632	missense	probably damaging	0.99
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- GGAATAATCACGTGCATAGGC -3'
(R):5'- GCAAGAAATGTAACCAGCTACTG -3'

Sequencing Primer
(F):5'- CGTGCATAGGCCTGCTTCATG -3'
(R):5'- AATGTAACCAGCTACTGAATATTGG -3'

Posted On

2019-06-26