Incidental Mutation 'R7219:Myo5a'
ID561667
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Namemyosin VA
Synonyms9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R7219 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location75071015-75223688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75120770 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 79 (Y79C)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
Predicted Effect probably damaging
Transcript: ENSMUST00000123128
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: Y79C

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably damaging
Transcript: ENSMUST00000136731
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: Y79C

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155282
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: Y79C

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,644 S300P unknown Het
Abhd17a T A 10: 80,584,174 K226* probably null Het
Alkbh7 T A 17: 56,998,508 H108Q probably damaging Het
Ankrd44 A C 1: 54,766,910 H112Q probably damaging Het
Capn3 A G 2: 120,503,454 E790G probably damaging Het
Cd47 C A 16: 49,908,077 N330K possibly damaging Het
Cd55 A G 1: 130,462,606 S22P possibly damaging Het
Cdc25a A G 9: 109,889,086 I373V probably damaging Het
Cfap43 T C 19: 47,791,473 I514V probably benign Het
Cfap73 A T 5: 120,630,135 M186K probably benign Het
Chd9 A G 8: 91,001,766 D1270G unknown Het
Ciita A G 16: 10,512,257 T802A probably benign Het
Dlgap2 A G 8: 14,743,296 E430G probably benign Het
Dlx1 C A 2: 71,530,169 S59* probably null Het
Dnaaf3 T C 7: 4,528,077 N119S probably damaging Het
Dnah11 T G 12: 118,041,095 I2164L possibly damaging Het
Dnah11 T C 12: 118,126,889 K1079R probably benign Het
Dnah12 C T 14: 26,854,880 T3029I probably damaging Het
Dppa3 A T 6: 122,629,959 Y136F probably damaging Het
Enox1 T A 14: 77,720,844 M611K probably benign Het
Fam149a A T 8: 45,350,563 I378N possibly damaging Het
Fam208b T A 13: 3,590,521 L205F probably damaging Het
Farp2 T C 1: 93,560,318 F89S probably damaging Het
Fbn2 C T 18: 58,053,027 V1750M probably benign Het
Frs3 A G 17: 47,702,695 T181A probably damaging Het
Heatr4 T A 12: 83,957,870 I726F possibly damaging Het
Ighg1 T G 12: 113,326,596 E375A Het
Ikzf4 G T 10: 128,634,383 Q476K possibly damaging Het
Kcnh1 G T 1: 192,505,637 C829F probably benign Het
Krtap19-4 T C 16: 88,884,909 Y53C unknown Het
Lor C A 3: 92,081,398 G194C unknown Het
Lrp1 A C 10: 127,557,228 D2720E probably benign Het
Lrp4 A G 2: 91,492,023 Y1068C probably damaging Het
Mbnl1 A G 3: 60,603,823 N67D probably benign Het
Mrpl21 A G 19: 3,286,998 E123G probably benign Het
Mst1 A T 9: 108,081,286 D65V probably damaging Het
Myo15b T A 11: 115,877,095 probably null Het
Oas1c A T 5: 120,802,892 W279R probably damaging Het
Olfr1283 A T 2: 111,369,537 I302L probably benign Het
Olfr1291-ps1 A T 2: 111,500,187 M312L probably benign Het
Olfr561 A G 7: 102,781,706 I77V probably benign Het
Pcdh9 C T 14: 93,015,780 G1149D possibly damaging Het
Pcid2 G A 8: 13,079,907 T283I probably benign Het
Pdhx A G 2: 103,028,415 V348A probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmb3 T A 11: 97,711,197 M131K probably null Het
Raph1 A G 1: 60,502,873 Y309H unknown Het
Rasgrf1 A G 9: 89,984,288 N593S probably damaging Het
Rbm38 A C 2: 173,022,197 E53A possibly damaging Het
Rufy3 A G 5: 88,649,856 T631A probably benign Het
Sbno1 A T 5: 124,405,659 D272E probably benign Het
Scamp1 T A 13: 94,224,907 Y207F probably damaging Het
Scn8a T A 15: 100,969,103 S263R probably damaging Het
Setbp1 T G 18: 78,755,745 T1407P probably damaging Het
Skor2 T C 18: 76,860,401 L606P possibly damaging Het
Slc35f6 A G 5: 30,657,452 N241S probably benign Het
Slc36a2 T G 11: 55,168,918 D247A probably benign Het
Smim10l1 T A 6: 133,107,932 F87L unknown Het
Son T C 16: 91,665,001 S2265P unknown Het
Spta1 A G 1: 174,222,637 N1748D probably damaging Het
Sptbn2 A G 19: 4,724,173 D84G probably damaging Het
Tbc1d24 G A 17: 24,185,292 R293C probably damaging Het
Tex15 A G 8: 33,546,240 T65A probably benign Het
Thyn1 A G 9: 27,005,210 Y97C probably damaging Het
Tmem64 T C 4: 15,266,700 L250P probably damaging Het
Tnfrsf9 A T 4: 150,935,534 K217N probably damaging Het
Tnxb A G 17: 34,679,065 T896A probably benign Het
Trpm1 T A 7: 64,204,585 I285N possibly damaging Het
Try5 T A 6: 41,311,703 D194V probably damaging Het
U2surp G A 9: 95,490,162 R316* probably null Het
Ubr2 G T 17: 46,935,434 S1618* probably null Het
Ugp2 T C 11: 21,323,271 I449M probably damaging Het
Umodl1 A G 17: 30,982,262 probably null Het
Vmn2r31 C T 7: 7,387,106 V538I probably benign Het
Vmn2r31 A T 7: 7,394,398 M287K probably damaging Het
Wwc2 A G 8: 47,858,884 V748A unknown Het
Zfp800 A C 6: 28,243,663 H434Q probably benign Het
Zfp869 A G 8: 69,706,706 C406R probably damaging Het
Zhx1 A G 15: 58,054,337 V171A probably benign Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7497:Myo5a UTSW 9 75197701 missense
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATAATCACGTGCATAGGC -3'
(R):5'- GCAAGAAATGTAACCAGCTACTG -3'

Sequencing Primer
(F):5'- CGTGCATAGGCCTGCTTCATG -3'
(R):5'- AATGTAACCAGCTACTGAATATTGG -3'
Posted On2019-06-26