Incidental Mutation 'R0594:Mkl1'
ID56169
Institutional Source Beutler Lab
Gene Symbol Mkl1
Ensembl Gene ENSMUSG00000042292
Gene NameMKL (megakaryoblastic leukemia)/myocardin-like 1
SynonymsMal, MRTF-A, Bsac
MMRRC Submission 038784-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R0594 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81012281-81190757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81017174 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 372 (T372I)
Ref Sequence ENSEMBL: ENSMUSP00000118451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000135047] [ENSMUST00000139517] [ENSMUST00000149582]
Predicted Effect probably damaging
Transcript: ENSMUST00000109579
AA Change: T407I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292
AA Change: T407I

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124845
Predicted Effect probably damaging
Transcript: ENSMUST00000131235
AA Change: T322I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292
AA Change: T322I

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134469
AA Change: T372I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292
AA Change: T372I

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135047
AA Change: T372I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118451
Gene: ENSMUSG00000042292
AA Change: T372I

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138769
Predicted Effect probably benign
Transcript: ENSMUST00000139517
SMART Domains Protein: ENSMUSP00000122543
Gene: ENSMUSG00000042303

DomainStartEndE-ValueType
TBC 111 328 3.6e-62 SMART
low complexity region 381 391 N/A INTRINSIC
SH3 483 538 6.34e-19 SMART
RUN 654 716 1.29e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145779
Predicted Effect probably benign
Transcript: ENSMUST00000149582
AA Change: T372I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292
AA Change: T372I

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Meta Mutation Damage Score 0.8526 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 99% (119/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the transcription factor myocardin, a key regulator of smooth muscle cell differentiation. The encoded protein is predominantly nuclear and may help transduce signals from the cytoskeleton to the nucleus. This gene is involved in a specific translocation event that creates a fusion of this gene and the RNA-binding motif protein-15 gene. This translocation has been associated with acute megakaryocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired mammary myoepithelial cell differentiation and fail to eject milk and productively nurse their offspring. Mice homozygous for another null allele show partial embryonic lethality caused by myocardial necrosis as well as mammary gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,389,880 V41A probably benign Het
Acad11 A G 9: 104,095,563 Q367R probably benign Het
Ackr4 A G 9: 104,099,004 V248A possibly damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Akap2 A G 4: 57,856,752 T694A probably benign Het
Ano2 A G 6: 125,982,765 M663V probably damaging Het
Apc2 T A 10: 80,306,256 C336* probably null Het
Arhgap17 A G 7: 123,294,518 S560P probably benign Het
Arl5a T C 2: 52,405,014 D128G probably damaging Het
Atp6v0a2 C A 5: 124,717,982 R678S probably benign Het
B4galnt2 C A 11: 95,891,909 A26S probably benign Het
C1qtnf1 A T 11: 118,446,628 T95S possibly damaging Het
Ccdc188 T A 16: 18,218,920 F241L probably benign Het
Cdh19 A T 1: 110,925,867 D281E probably benign Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cherp A T 8: 72,462,402 probably null Het
Cpne9 T A 6: 113,290,400 probably benign Het
Cthrc1 A T 15: 39,077,142 R47W possibly damaging Het
Dcaf13 A G 15: 39,123,268 E145G probably benign Het
Dcaf4 T A 12: 83,538,043 probably null Het
Dgka A C 10: 128,733,110 probably benign Het
Dhrs13 T A 11: 78,034,525 F157L probably damaging Het
Dnajb5 A T 4: 42,956,577 Y88F probably damaging Het
Dpp8 A G 9: 65,036,998 T16A probably damaging Het
Dscc1 A T 15: 55,089,052 I91K possibly damaging Het
Efemp2 T A 19: 5,475,063 probably benign Het
Elf2 T C 3: 51,256,453 T504A possibly damaging Het
Elk3 G A 10: 93,265,160 S243F probably damaging Het
Ell2 A G 13: 75,749,993 D93G probably damaging Het
Eln G T 5: 134,712,398 probably benign Het
Eme1 C T 11: 94,650,430 D189N possibly damaging Het
Epb41l2 A G 10: 25,443,770 E167G possibly damaging Het
Exoc5 A T 14: 49,036,087 probably benign Het
Fam129c C A 8: 71,599,135 A38E probably benign Het
Fam170b A G 14: 32,836,314 K369E unknown Het
Fam187b T A 7: 30,977,154 C29* probably null Het
Fam20c T C 5: 138,766,637 S260P possibly damaging Het
Fam216b G A 14: 78,086,674 A21V possibly damaging Het
Fam98a A T 17: 75,538,487 Y421* probably null Het
Farp2 T C 1: 93,576,500 V333A probably damaging Het
Fcgr1 T C 3: 96,292,312 Y93C probably damaging Het
Fgd2 A T 17: 29,365,552 I157F probably damaging Het
Frmd4b T A 6: 97,325,426 probably benign Het
Fut9 T C 4: 25,620,526 D96G possibly damaging Het
Glt8d1 G A 14: 31,010,410 probably null Het
Gm7579 T A 7: 142,212,384 C176S unknown Het
Gmpr2 A G 14: 55,677,988 E272G probably damaging Het
Grin2b T C 6: 135,733,929 H873R probably damaging Het
Gtf2i C T 5: 134,242,173 probably benign Het
Htr3b A T 9: 48,947,631 V69E probably benign Het
Icam5 A G 9: 21,035,598 N474S probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jag1 T A 2: 137,087,080 I819L probably damaging Het
Kif9 A T 9: 110,511,340 E467V probably benign Het
Krit1 T C 5: 3,823,694 L491P possibly damaging Het
Lipo2 T G 19: 33,746,902 I155L possibly damaging Het
Lmbr1 A G 5: 29,292,209 F65L possibly damaging Het
Lsp1 G A 7: 142,488,950 probably benign Het
Marc2 T C 1: 184,841,339 N121D probably benign Het
Mgat5 T A 1: 127,412,248 D455E probably damaging Het
Mical2 A T 7: 112,318,450 Y338F probably damaging Het
Mre11a T G 9: 14,815,209 S396A probably benign Het
Myo3a C T 2: 22,544,332 probably benign Het
Naca T C 10: 128,040,355 probably benign Het
Nav1 A T 1: 135,467,643 I996K possibly damaging Het
Ncbp1 A G 4: 46,170,551 N742S probably benign Het
Ndufaf3 G A 9: 108,566,923 A2V probably benign Het
Ntn5 G T 7: 45,686,681 A47S probably damaging Het
Olfr1122 T A 2: 87,387,954 I83N probably damaging Het
Olfr13 T A 6: 43,174,607 V207E possibly damaging Het
Olfr1502 G T 19: 13,862,279 C162F probably benign Het
Olfr384 G A 11: 73,603,392 E271K probably benign Het
Olfr392 T C 11: 73,814,617 H155R probably benign Het
Olfr777 T C 10: 129,269,152 Y57C possibly damaging Het
Otud7a T A 7: 63,727,472 L203* probably null Het
Pcdhb13 A G 18: 37,443,931 Y454C probably damaging Het
Pdzph1 C T 17: 58,954,479 V853M possibly damaging Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Pm20d2 C T 4: 33,181,746 E286K probably damaging Het
Polr2i T A 7: 30,232,745 probably null Het
Ppp1r12b A G 1: 134,776,479 L879P probably damaging Het
Prf1 C A 10: 61,303,722 Y486* probably null Het
Qsox2 T G 2: 26,214,044 T325P probably damaging Het
Rab1b G T 19: 5,100,656 probably benign Het
Rbm19 T C 5: 120,128,316 probably null Het
Rhobtb2 A G 14: 69,793,948 V576A probably benign Het
Rnps1 G A 17: 24,424,437 V215M probably damaging Het
Rps11 A G 7: 45,124,282 probably benign Het
Serpinb3d C T 1: 107,079,347 M210I probably damaging Het
Sgsm1 T C 5: 113,310,562 T17A probably benign Het
Slc6a3 A G 13: 73,538,642 T43A probably damaging Het
Sox4 C G 13: 28,952,904 A40P probably damaging Het
Spry2 A T 14: 105,893,310 D147E possibly damaging Het
Stpg1 A G 4: 135,519,431 N157D possibly damaging Het
Sumf1 T C 6: 108,173,414 D152G probably benign Het
Tbr1 T C 2: 61,811,620 S410P possibly damaging Het
Tdrd6 A G 17: 43,629,383 V258A probably damaging Het
Tirap C T 9: 35,188,761 G209D probably damaging Het
Tnfrsf8 A T 4: 145,296,861 V134D probably damaging Het
Tnr A G 1: 159,850,335 T97A probably benign Het
Tspan32 T A 7: 143,015,610 F135L probably damaging Het
Ttn T C 2: 76,789,056 K16021E probably damaging Het
Tusc3 T A 8: 39,096,968 I251N probably damaging Het
Usp38 A T 8: 81,005,366 I305N probably damaging Het
Usp4 T A 9: 108,370,881 probably null Het
Usp5 A T 6: 124,817,424 D764E probably damaging Het
Vangl2 A T 1: 172,004,657 V544E probably damaging Het
Vldlr G A 19: 27,234,819 V78M probably damaging Het
Vmn1r29 T C 6: 58,307,772 V159A probably benign Het
Vmn2r16 T A 5: 109,363,896 F656L probably damaging Het
Wdfy3 T A 5: 101,906,185 I1590F possibly damaging Het
Xpo1 T A 11: 23,280,402 V263E probably damaging Het
Zbtb38 A G 9: 96,685,954 S1026P probably damaging Het
Zfp407 A T 18: 84,562,567 D140E possibly damaging Het
Zfp637 T A 6: 117,845,686 Y258* probably null Het
Zfp951 T A 5: 104,814,572 Q376L possibly damaging Het
Other mutations in Mkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mkl1 APN 15 81016302 missense probably damaging 1.00
IGL02831:Mkl1 APN 15 81104793 missense probably benign 0.14
IGL03060:Mkl1 APN 15 81045322 missense probably damaging 1.00
Betcha UTSW 15 81018448 nonsense probably null
R0648:Mkl1 UTSW 15 81016920 missense probably damaging 1.00
R1085:Mkl1 UTSW 15 81020883 missense probably damaging 1.00
R1476:Mkl1 UTSW 15 81018208 splice site probably benign
R4030:Mkl1 UTSW 15 81015784 missense probably benign 0.01
R4232:Mkl1 UTSW 15 81023595 missense probably damaging 1.00
R4307:Mkl1 UTSW 15 81016347 missense possibly damaging 0.88
R4400:Mkl1 UTSW 15 81020923 nonsense probably null
R4795:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4796:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4801:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4802:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4899:Mkl1 UTSW 15 81018386 missense probably damaging 1.00
R4967:Mkl1 UTSW 15 81045275 splice site probably benign
R5071:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5072:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5073:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5074:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R6186:Mkl1 UTSW 15 81016652 missense probably damaging 1.00
R6512:Mkl1 UTSW 15 81013716 missense probably benign
R6581:Mkl1 UTSW 15 81016373 missense probably damaging 1.00
R6997:Mkl1 UTSW 15 81018448 nonsense probably null
RF023:Mkl1 UTSW 15 81015856 missense probably damaging 1.00
RF024:Mkl1 UTSW 15 81018255 small deletion probably benign
X0013:Mkl1 UTSW 15 81022436 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCTGTTACAAGAGCTGACCCTG -3'
(R):5'- CTTGCTGCTCCATAGCGATATGACC -3'

Sequencing Primer
(F):5'- AAGAGCTGACCCTGTGCTTAG -3'
(R):5'- GCGATATGACCTCAAGGCTG -3'
Posted On2013-07-11