Incidental Mutation 'R7219:Umodl1'
ID561697
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7219 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 30982262 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066554] [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000066981] [ENSMUST00000066981] [ENSMUST00000114555] [ENSMUST00000114555] [ENSMUST00000114555]
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.9480 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,644 S300P unknown Het
Abhd17a T A 10: 80,584,174 K226* probably null Het
Alkbh7 T A 17: 56,998,508 H108Q probably damaging Het
Ankrd44 A C 1: 54,766,910 H112Q probably damaging Het
Capn3 A G 2: 120,503,454 E790G probably damaging Het
Cd47 C A 16: 49,908,077 N330K possibly damaging Het
Cd55 A G 1: 130,462,606 S22P possibly damaging Het
Cdc25a A G 9: 109,889,086 I373V probably damaging Het
Cfap43 T C 19: 47,791,473 I514V probably benign Het
Cfap73 A T 5: 120,630,135 M186K probably benign Het
Chd9 A G 8: 91,001,766 D1270G unknown Het
Ciita A G 16: 10,512,257 T802A probably benign Het
Dlgap2 A G 8: 14,743,296 E430G probably benign Het
Dlx1 C A 2: 71,530,169 S59* probably null Het
Dnaaf3 T C 7: 4,528,077 N119S probably damaging Het
Dnah11 T G 12: 118,041,095 I2164L possibly damaging Het
Dnah11 T C 12: 118,126,889 K1079R probably benign Het
Dnah12 C T 14: 26,854,880 T3029I probably damaging Het
Dppa3 A T 6: 122,629,959 Y136F probably damaging Het
Enox1 T A 14: 77,720,844 M611K probably benign Het
Fam149a A T 8: 45,350,563 I378N possibly damaging Het
Fam208b T A 13: 3,590,521 L205F probably damaging Het
Farp2 T C 1: 93,560,318 F89S probably damaging Het
Fbn2 C T 18: 58,053,027 V1750M probably benign Het
Frs3 A G 17: 47,702,695 T181A probably damaging Het
Heatr4 T A 12: 83,957,870 I726F possibly damaging Het
Ighg1 T G 12: 113,326,596 E375A Het
Ikzf4 G T 10: 128,634,383 Q476K possibly damaging Het
Kcnh1 G T 1: 192,505,637 C829F probably benign Het
Krtap19-4 T C 16: 88,884,909 Y53C unknown Het
Lor C A 3: 92,081,398 G194C unknown Het
Lrp1 A C 10: 127,557,228 D2720E probably benign Het
Lrp4 A G 2: 91,492,023 Y1068C probably damaging Het
Mbnl1 A G 3: 60,603,823 N67D probably benign Het
Mrpl21 A G 19: 3,286,998 E123G probably benign Het
Mst1 A T 9: 108,081,286 D65V probably damaging Het
Myo15b T A 11: 115,877,095 probably null Het
Myo5a A G 9: 75,120,770 Y79C probably damaging Het
Oas1c A T 5: 120,802,892 W279R probably damaging Het
Olfr1283 A T 2: 111,369,537 I302L probably benign Het
Olfr1291-ps1 A T 2: 111,500,187 M312L probably benign Het
Olfr561 A G 7: 102,781,706 I77V probably benign Het
Pcdh9 C T 14: 93,015,780 G1149D possibly damaging Het
Pcid2 G A 8: 13,079,907 T283I probably benign Het
Pdhx A G 2: 103,028,415 V348A probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmb3 T A 11: 97,711,197 M131K probably null Het
Raph1 A G 1: 60,502,873 Y309H unknown Het
Rasgrf1 A G 9: 89,984,288 N593S probably damaging Het
Rbm38 A C 2: 173,022,197 E53A possibly damaging Het
Rufy3 A G 5: 88,649,856 T631A probably benign Het
Sbno1 A T 5: 124,405,659 D272E probably benign Het
Scamp1 T A 13: 94,224,907 Y207F probably damaging Het
Scn8a T A 15: 100,969,103 S263R probably damaging Het
Setbp1 T G 18: 78,755,745 T1407P probably damaging Het
Skor2 T C 18: 76,860,401 L606P possibly damaging Het
Slc35f6 A G 5: 30,657,452 N241S probably benign Het
Slc36a2 T G 11: 55,168,918 D247A probably benign Het
Smim10l1 T A 6: 133,107,932 F87L unknown Het
Son T C 16: 91,665,001 S2265P unknown Het
Spta1 A G 1: 174,222,637 N1748D probably damaging Het
Sptbn2 A G 19: 4,724,173 D84G probably damaging Het
Tbc1d24 G A 17: 24,185,292 R293C probably damaging Het
Tex15 A G 8: 33,546,240 T65A probably benign Het
Thyn1 A G 9: 27,005,210 Y97C probably damaging Het
Tmem64 T C 4: 15,266,700 L250P probably damaging Het
Tnfrsf9 A T 4: 150,935,534 K217N probably damaging Het
Tnxb A G 17: 34,679,065 T896A probably benign Het
Trpm1 T A 7: 64,204,585 I285N possibly damaging Het
Try5 T A 6: 41,311,703 D194V probably damaging Het
U2surp G A 9: 95,490,162 R316* probably null Het
Ubr2 G T 17: 46,935,434 S1618* probably null Het
Ugp2 T C 11: 21,323,271 I449M probably damaging Het
Vmn2r31 C T 7: 7,387,106 V538I probably benign Het
Vmn2r31 A T 7: 7,394,398 M287K probably damaging Het
Wwc2 A G 8: 47,858,884 V748A unknown Het
Zfp800 A C 6: 28,243,663 H434Q probably benign Het
Zfp869 A G 8: 69,706,706 C406R probably damaging Het
Zhx1 A G 15: 58,054,337 V171A probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
floored UTSW 17 30988057 nonsense probably null
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTCAGTGTTACCATTCCTTG -3'
(R):5'- TGCGTCCTTGTTCCGAGTAC -3'

Sequencing Primer
(F):5'- GTCAGTGTTACCATTCCTTGTATAG -3'
(R):5'- TCCGAGTACTTGAGGGCAG -3'
Posted On2019-06-26