Incidental Mutation 'R0594:Abcc1'
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission 038784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0594 (G1)
Quality Score225
Status Validated
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14389880 bp
Amino Acid Change Valine to Alanine at position 41 (V41A)
Ref Sequence ENSEMBL: ENSMUSP00000115763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000134776] [ENSMUST00000144676] [ENSMUST00000147759] [ENSMUST00000154748]
Predicted Effect probably benign
Transcript: ENSMUST00000100167
AA Change: V41A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: V41A

transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
AA Change: V41A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088
AA Change: V41A

transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
AA Change: V41A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088
AA Change: V41A

transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134776
AA Change: V41A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120933
Gene: ENSMUSG00000023088
AA Change: V41A

transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144074
Predicted Effect probably benign
Transcript: ENSMUST00000144676
AA Change: V27A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116726
Gene: ENSMUSG00000023088
AA Change: V27A

transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 63 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147759
AA Change: V41A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088
AA Change: V41A

transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154748
AA Change: V41A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115763
Gene: ENSMUSG00000023088
AA Change: V41A

transmembrane domain 36 58 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 115 137 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 99% (119/120)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 A G 9: 104,095,563 Q367R probably benign Het
Ackr4 A G 9: 104,099,004 V248A possibly damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Akap2 A G 4: 57,856,752 T694A probably benign Het
Ano2 A G 6: 125,982,765 M663V probably damaging Het
Apc2 T A 10: 80,306,256 C336* probably null Het
Arhgap17 A G 7: 123,294,518 S560P probably benign Het
Arl5a T C 2: 52,405,014 D128G probably damaging Het
Atp6v0a2 C A 5: 124,717,982 R678S probably benign Het
B4galnt2 C A 11: 95,891,909 A26S probably benign Het
C1qtnf1 A T 11: 118,446,628 T95S possibly damaging Het
Ccdc188 T A 16: 18,218,920 F241L probably benign Het
Cdh19 A T 1: 110,925,867 D281E probably benign Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cherp A T 8: 72,462,402 probably null Het
Cpne9 T A 6: 113,290,400 probably benign Het
Cthrc1 A T 15: 39,077,142 R47W possibly damaging Het
Dcaf13 A G 15: 39,123,268 E145G probably benign Het
Dcaf4 T A 12: 83,538,043 probably null Het
Dgka A C 10: 128,733,110 probably benign Het
Dhrs13 T A 11: 78,034,525 F157L probably damaging Het
Dnajb5 A T 4: 42,956,577 Y88F probably damaging Het
Dpp8 A G 9: 65,036,998 T16A probably damaging Het
Dscc1 A T 15: 55,089,052 I91K possibly damaging Het
Efemp2 T A 19: 5,475,063 probably benign Het
Elf2 T C 3: 51,256,453 T504A possibly damaging Het
Elk3 G A 10: 93,265,160 S243F probably damaging Het
Ell2 A G 13: 75,749,993 D93G probably damaging Het
Eln G T 5: 134,712,398 probably benign Het
Eme1 C T 11: 94,650,430 D189N possibly damaging Het
Epb41l2 A G 10: 25,443,770 E167G possibly damaging Het
Exoc5 A T 14: 49,036,087 probably benign Het
Fam129c C A 8: 71,599,135 A38E probably benign Het
Fam170b A G 14: 32,836,314 K369E unknown Het
Fam187b T A 7: 30,977,154 C29* probably null Het
Fam20c T C 5: 138,766,637 S260P possibly damaging Het
Fam216b G A 14: 78,086,674 A21V possibly damaging Het
Fam98a A T 17: 75,538,487 Y421* probably null Het
Farp2 T C 1: 93,576,500 V333A probably damaging Het
Fcgr1 T C 3: 96,292,312 Y93C probably damaging Het
Fgd2 A T 17: 29,365,552 I157F probably damaging Het
Frmd4b T A 6: 97,325,426 probably benign Het
Fut9 T C 4: 25,620,526 D96G possibly damaging Het
Glt8d1 G A 14: 31,010,410 probably null Het
Gm7579 T A 7: 142,212,384 C176S unknown Het
Gmpr2 A G 14: 55,677,988 E272G probably damaging Het
Grin2b T C 6: 135,733,929 H873R probably damaging Het
Gtf2i C T 5: 134,242,173 probably benign Het
Htr3b A T 9: 48,947,631 V69E probably benign Het
Icam5 A G 9: 21,035,598 N474S probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jag1 T A 2: 137,087,080 I819L probably damaging Het
Kif9 A T 9: 110,511,340 E467V probably benign Het
Krit1 T C 5: 3,823,694 L491P possibly damaging Het
Lipo2 T G 19: 33,746,902 I155L possibly damaging Het
Lmbr1 A G 5: 29,292,209 F65L possibly damaging Het
Lsp1 G A 7: 142,488,950 probably benign Het
Marc2 T C 1: 184,841,339 N121D probably benign Het
Mgat5 T A 1: 127,412,248 D455E probably damaging Het
Mical2 A T 7: 112,318,450 Y338F probably damaging Het
Mkl1 G A 15: 81,017,174 T372I probably damaging Het
Mre11a T G 9: 14,815,209 S396A probably benign Het
Myo3a C T 2: 22,544,332 probably benign Het
Naca T C 10: 128,040,355 probably benign Het
Nav1 A T 1: 135,467,643 I996K possibly damaging Het
Ncbp1 A G 4: 46,170,551 N742S probably benign Het
Ndufaf3 G A 9: 108,566,923 A2V probably benign Het
Ntn5 G T 7: 45,686,681 A47S probably damaging Het
Olfr1122 T A 2: 87,387,954 I83N probably damaging Het
Olfr13 T A 6: 43,174,607 V207E possibly damaging Het
Olfr1502 G T 19: 13,862,279 C162F probably benign Het
Olfr384 G A 11: 73,603,392 E271K probably benign Het
Olfr392 T C 11: 73,814,617 H155R probably benign Het
Olfr777 T C 10: 129,269,152 Y57C possibly damaging Het
Otud7a T A 7: 63,727,472 L203* probably null Het
Pcdhb13 A G 18: 37,443,931 Y454C probably damaging Het
Pdzph1 C T 17: 58,954,479 V853M possibly damaging Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Pm20d2 C T 4: 33,181,746 E286K probably damaging Het
Polr2i T A 7: 30,232,745 probably null Het
Ppp1r12b A G 1: 134,776,479 L879P probably damaging Het
Prf1 C A 10: 61,303,722 Y486* probably null Het
Qsox2 T G 2: 26,214,044 T325P probably damaging Het
Rab1b G T 19: 5,100,656 probably benign Het
Rbm19 T C 5: 120,128,316 probably null Het
Rhobtb2 A G 14: 69,793,948 V576A probably benign Het
Rnps1 G A 17: 24,424,437 V215M probably damaging Het
Rps11 A G 7: 45,124,282 probably benign Het
Serpinb3d C T 1: 107,079,347 M210I probably damaging Het
Sgsm1 T C 5: 113,310,562 T17A probably benign Het
Slc6a3 A G 13: 73,538,642 T43A probably damaging Het
Sox4 C G 13: 28,952,904 A40P probably damaging Het
Spry2 A T 14: 105,893,310 D147E possibly damaging Het
Stpg1 A G 4: 135,519,431 N157D possibly damaging Het
Sumf1 T C 6: 108,173,414 D152G probably benign Het
Tbr1 T C 2: 61,811,620 S410P possibly damaging Het
Tdrd6 A G 17: 43,629,383 V258A probably damaging Het
Tirap C T 9: 35,188,761 G209D probably damaging Het
Tnfrsf8 A T 4: 145,296,861 V134D probably damaging Het
Tnr A G 1: 159,850,335 T97A probably benign Het
Tspan32 T A 7: 143,015,610 F135L probably damaging Het
Ttn T C 2: 76,789,056 K16021E probably damaging Het
Tusc3 T A 8: 39,096,968 I251N probably damaging Het
Usp38 A T 8: 81,005,366 I305N probably damaging Het
Usp4 T A 9: 108,370,881 probably null Het
Usp5 A T 6: 124,817,424 D764E probably damaging Het
Vangl2 A T 1: 172,004,657 V544E probably damaging Het
Vldlr G A 19: 27,234,819 V78M probably damaging Het
Vmn1r29 T C 6: 58,307,772 V159A probably benign Het
Vmn2r16 T A 5: 109,363,896 F656L probably damaging Het
Wdfy3 T A 5: 101,906,185 I1590F possibly damaging Het
Xpo1 T A 11: 23,280,402 V263E probably damaging Het
Zbtb38 A G 9: 96,685,954 S1026P probably damaging Het
Zfp407 A T 18: 84,562,567 D140E possibly damaging Het
Zfp637 T A 6: 117,845,686 Y258* probably null Het
Zfp951 T A 5: 104,814,572 Q376L possibly damaging Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
gloom UTSW 16 14411616 missense probably damaging 1.00
loom UTSW 16 14472930 missense probably damaging 0.96
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14448579 missense probably benign
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14472887 missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14472930 missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14396451 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tggggaaactgaggaaatgg -3'
Posted On2013-07-11