Mutagenetix > Incidental Mutations

Incidental Mutation 'R7219:Setbp1'

561704

Institutional Source

Beutler Lab

Gene Symbol

Setbp1

Ensembl Gene

ENSMUSG00000024548

Gene Name

SET binding protein 1

Synonyms

Seb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.573) question?

Stock #

R7219 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78750380-79109391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 78755745 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 1407 (T1407P)

Ref Sequence

ENSEMBL: ENSMUSP00000025430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025430]

AlphaFold

Q9Z180

Predicted Effect

probably damaging
Transcript: ENSMUST00000025430
AA Change: T1407P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: T1407P

Domain	Start	End	E-Value	Type
low complexity region	155	165	N/A	INTRINSIC
low complexity region	221	251	N/A	INTRINSIC
low complexity region	278	286	N/A	INTRINSIC
AT_hook	528	540	4.64e-1	SMART
low complexity region	565	571	N/A	INTRINSIC
low complexity region	594	617	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC
AT_hook	960	972	1.89e-1	SMART
low complexity region	1086	1103	N/A	INTRINSIC
low complexity region	1316	1337	N/A	INTRINSIC
AT_hook	1393	1405	7.27e-1	SMART
low complexity region	1462	1486	N/A	INTRINSIC
low complexity region	1498	1514	N/A	INTRINSIC

Meta Mutation Damage Score

0.1142

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,849,644	S300P	unknown	Het
Abhd17a	T	A	10: 80,584,174	K226*	probably null	Het
Alkbh7	T	A	17: 56,998,508	H108Q	probably damaging	Het
Ankrd44	A	C	1: 54,766,910	H112Q	probably damaging	Het
Capn3	A	G	2: 120,503,454	E790G	probably damaging	Het
Cd47	C	A	16: 49,908,077	N330K	possibly damaging	Het
Cd55	A	G	1: 130,462,606	S22P	possibly damaging	Het
Cdc25a	A	G	9: 109,889,086	I373V	probably damaging	Het
Cfap43	T	C	19: 47,791,473	I514V	probably benign	Het
Cfap73	A	T	5: 120,630,135	M186K	probably benign	Het
Chd9	A	G	8: 91,001,766	D1270G	unknown	Het
Ciita	A	G	16: 10,512,257	T802A	probably benign	Het
Dlgap2	A	G	8: 14,743,296	E430G	probably benign	Het
Dlx1	C	A	2: 71,530,169	S59*	probably null	Het
Dnaaf3	T	C	7: 4,528,077	N119S	probably damaging	Het
Dnah11	T	G	12: 118,041,095	I2164L	possibly damaging	Het
Dnah11	T	C	12: 118,126,889	K1079R	probably benign	Het
Dnah12	C	T	14: 26,854,880	T3029I	probably damaging	Het
Dppa3	A	T	6: 122,629,959	Y136F	probably damaging	Het
Enox1	T	A	14: 77,720,844	M611K	probably benign	Het
Fam149a	A	T	8: 45,350,563	I378N	possibly damaging	Het
Fam208b	T	A	13: 3,590,521	L205F	probably damaging	Het
Farp2	T	C	1: 93,560,318	F89S	probably damaging	Het
Fbn2	C	T	18: 58,053,027	V1750M	probably benign	Het
Frs3	A	G	17: 47,702,695	T181A	probably damaging	Het
Heatr4	T	A	12: 83,957,870	I726F	possibly damaging	Het
Ighg1	T	G	12: 113,326,596	E375A		Het
Ikzf4	G	T	10: 128,634,383	Q476K	possibly damaging	Het
Kcnh1	G	T	1: 192,505,637	C829F	probably benign	Het
Krtap19-4	T	C	16: 88,884,909	Y53C	unknown	Het
Lor	C	A	3: 92,081,398	G194C	unknown	Het
Lrp1	A	C	10: 127,557,228	D2720E	probably benign	Het
Lrp4	A	G	2: 91,492,023	Y1068C	probably damaging	Het
Mbnl1	A	G	3: 60,603,823	N67D	probably benign	Het
Mrpl21	A	G	19: 3,286,998	E123G	probably benign	Het
Mst1	A	T	9: 108,081,286	D65V	probably damaging	Het
Myo15b	T	A	11: 115,877,095		probably null	Het
Myo5a	A	G	9: 75,120,770	Y79C	probably damaging	Het
Oas1c	A	T	5: 120,802,892	W279R	probably damaging	Het
Olfr1283	A	T	2: 111,369,537	I302L	probably benign	Het
Olfr1291-ps1	A	T	2: 111,500,187	M312L	probably benign	Het
Olfr561	A	G	7: 102,781,706	I77V	probably benign	Het
Pcdh9	C	T	14: 93,015,780	G1149D	possibly damaging	Het
Pcid2	G	A	8: 13,079,907	T283I	probably benign	Het
Pdhx	A	G	2: 103,028,415	V348A	probably benign	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Psmb3	T	A	11: 97,711,197	M131K	probably null	Het
Raph1	A	G	1: 60,502,873	Y309H	unknown	Het
Rasgrf1	A	G	9: 89,984,288	N593S	probably damaging	Het
Rbm38	A	C	2: 173,022,197	E53A	possibly damaging	Het
Rufy3	A	G	5: 88,649,856	T631A	probably benign	Het
Sbno1	A	T	5: 124,405,659	D272E	probably benign	Het
Scamp1	T	A	13: 94,224,907	Y207F	probably damaging	Het
Scn8a	T	A	15: 100,969,103	S263R	probably damaging	Het
Skor2	T	C	18: 76,860,401	L606P	possibly damaging	Het
Slc35f6	A	G	5: 30,657,452	N241S	probably benign	Het
Slc36a2	T	G	11: 55,168,918	D247A	probably benign	Het
Smim10l1	T	A	6: 133,107,932	F87L	unknown	Het
Son	T	C	16: 91,665,001	S2265P	unknown	Het
Spta1	A	G	1: 174,222,637	N1748D	probably damaging	Het
Sptbn2	A	G	19: 4,724,173	D84G	probably damaging	Het
Tbc1d24	G	A	17: 24,185,292	R293C	probably damaging	Het
Tex15	A	G	8: 33,546,240	T65A	probably benign	Het
Thyn1	A	G	9: 27,005,210	Y97C	probably damaging	Het
Tmem64	T	C	4: 15,266,700	L250P	probably damaging	Het
Tnfrsf9	A	T	4: 150,935,534	K217N	probably damaging	Het
Tnxb	A	G	17: 34,679,065	T896A	probably benign	Het
Trpm1	T	A	7: 64,204,585	I285N	possibly damaging	Het
Try5	T	A	6: 41,311,703	D194V	probably damaging	Het
U2surp	G	A	9: 95,490,162	R316*	probably null	Het
Ubr2	G	T	17: 46,935,434	S1618*	probably null	Het
Ugp2	T	C	11: 21,323,271	I449M	probably damaging	Het
Umodl1	A	G	17: 30,982,262		probably null	Het
Vmn2r31	C	T	7: 7,387,106	V538I	probably benign	Het
Vmn2r31	A	T	7: 7,394,398	M287K	probably damaging	Het
Wwc2	A	G	8: 47,858,884	V748A	unknown	Het
Zfp800	A	C	6: 28,243,663	H434Q	probably benign	Het
Zfp869	A	G	8: 69,706,706	C406R	probably damaging	Het
Zhx1	A	G	15: 58,054,337	V171A	probably benign	Het

Other mutations in Setbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Setbp1	APN	18	78755679	nonsense	probably null	0.00
IGL00668:Setbp1	APN	18	78857770	missense	probably damaging	1.00
IGL01628:Setbp1	APN	18	78856777	missense	probably damaging	1.00
IGL02084:Setbp1	APN	18	78857410	missense	probably damaging	1.00
IGL02405:Setbp1	APN	18	78857299	missense	probably damaging	1.00
IGL02427:Setbp1	APN	18	78857473	missense	probably damaging	1.00
IGL02612:Setbp1	APN	18	78755710	missense	probably damaging	1.00
IGL02725:Setbp1	APN	18	78857374	nonsense	probably null
IGL03005:Setbp1	APN	18	78859125	missense	possibly damaging	0.75
IGL03123:Setbp1	APN	18	78857009	missense	probably damaging	1.00
R1083:Setbp1	UTSW	18	78857626	missense	probably damaging	1.00
R1110:Setbp1	UTSW	18	78857860	missense	probably damaging	1.00
R1167:Setbp1	UTSW	18	78857236	missense	possibly damaging	0.85
R1221:Setbp1	UTSW	18	78856583	missense	probably damaging	1.00
R1225:Setbp1	UTSW	18	78858208	missense	probably damaging	0.99
R1327:Setbp1	UTSW	18	78783358	missense	probably benign	0.00
R1481:Setbp1	UTSW	18	78783301	missense	probably benign	0.01
R1482:Setbp1	UTSW	18	79086835	missense	probably damaging	1.00
R1496:Setbp1	UTSW	18	78859912	missense	probably damaging	1.00
R1550:Setbp1	UTSW	18	78858592	missense	probably damaging	1.00
R1708:Setbp1	UTSW	18	78858467	missense	probably damaging	0.99
R1751:Setbp1	UTSW	18	78857398	missense	probably damaging	1.00
R1922:Setbp1	UTSW	18	78858362	missense	possibly damaging	0.75
R1986:Setbp1	UTSW	18	78858544	missense	probably damaging	0.99
R2090:Setbp1	UTSW	18	78856720	missense	probably benign	0.00
R2851:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2853:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2941:Setbp1	UTSW	18	78858197	missense	probably damaging	1.00
R3151:Setbp1	UTSW	18	78857435	missense	probably damaging	1.00
R3156:Setbp1	UTSW	18	78859303	missense	probably benign	0.00
R3807:Setbp1	UTSW	18	78783322	missense	probably benign	0.01
R4133:Setbp1	UTSW	18	78856991	missense	probably benign	0.05
R4287:Setbp1	UTSW	18	78859061	missense	probably benign	0.03
R4345:Setbp1	UTSW	18	79086579	missense	probably damaging	0.99
R4374:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4377:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4378:Setbp1	UTSW	18	78856618	missense	possibly damaging	0.95
R4379:Setbp1	UTSW	18	79086681	missense	probably damaging	1.00
R4585:Setbp1	UTSW	18	79086949	missense	probably benign	0.00
R4595:Setbp1	UTSW	18	78857516	missense	probably benign	0.00
R4817:Setbp1	UTSW	18	78858800	missense	probably damaging	1.00
R4971:Setbp1	UTSW	18	78858167	missense	probably benign	0.07
R4976:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5017:Setbp1	UTSW	18	78856594	missense	possibly damaging	0.81
R5066:Setbp1	UTSW	18	78857299	missense	probably damaging	1.00
R5133:Setbp1	UTSW	18	78857482	missense	probably damaging	1.00
R5151:Setbp1	UTSW	18	78857999	missense	probably damaging	1.00
R5237:Setbp1	UTSW	18	78856975	missense	possibly damaging	0.92
R5480:Setbp1	UTSW	18	78858063	missense	probably damaging	0.99
R5507:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5529:Setbp1	UTSW	18	79086652	missense	probably damaging	0.99
R5622:Setbp1	UTSW	18	78857485	missense	probably damaging	1.00
R5722:Setbp1	UTSW	18	78856645	missense	possibly damaging	0.95
R5806:Setbp1	UTSW	18	78856482	splice site	probably null
R5940:Setbp1	UTSW	18	78755488	missense	probably damaging	1.00
R6025:Setbp1	UTSW	18	78859240	missense	probably damaging	0.98
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6250:Setbp1	UTSW	18	78858002	missense	probably benign	0.00
R6256:Setbp1	UTSW	18	78857257	missense	probably damaging	1.00
R6332:Setbp1	UTSW	18	78783369	missense	probably benign	0.21
R6522:Setbp1	UTSW	18	78857390	missense	probably damaging	0.98
R6873:Setbp1	UTSW	18	78859559	missense	probably benign	0.00
R6886:Setbp1	UTSW	18	78857500	missense	probably damaging	1.00
R6986:Setbp1	UTSW	18	78857839	missense	probably damaging	1.00
R7042:Setbp1	UTSW	18	79086855	missense	probably damaging	1.00
R7131:Setbp1	UTSW	18	79086960	missense	probably benign	0.08
R7134:Setbp1	UTSW	18	78859519	missense	possibly damaging	0.86
R7215:Setbp1	UTSW	18	78856837	missense	probably damaging	0.97
R7378:Setbp1	UTSW	18	78857486	missense	probably damaging	1.00
R7461:Setbp1	UTSW	18	78856492	missense	probably benign	0.06
R7589:Setbp1	UTSW	18	78856492	missense	probably benign	0.01
R7840:Setbp1	UTSW	18	78783424	missense	probably benign	0.03
R7849:Setbp1	UTSW	18	78856853	missense	probably benign	0.00
R8147:Setbp1	UTSW	18	78856800	missense	probably damaging	1.00
R8354:Setbp1	UTSW	18	78857383	missense	probably damaging	1.00
R8446:Setbp1	UTSW	18	78857756	missense	probably damaging	1.00
R8524:Setbp1	UTSW	18	78858754	missense	probably damaging	1.00
R8534:Setbp1	UTSW	18	78783327	missense	possibly damaging	0.86
R8694:Setbp1	UTSW	18	78858301	missense	probably damaging	1.00
R8931:Setbp1	UTSW	18	78856508	missense	probably benign	0.00
R8983:Setbp1	UTSW	18	78859244	missense	probably benign	0.37
R9062:Setbp1	UTSW	18	78857051	missense	probably benign	0.01
R9113:Setbp1	UTSW	18	78857733	missense	probably damaging	0.99
R9364:Setbp1	UTSW	18	78783384	missense	probably benign	0.00
Z1088:Setbp1	UTSW	18	78859594	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGGTAGGTCAATGCACTTTTCCAG -3'
(R):5'- TGCTTTGTACACGTGATGTAGTCAG -3'

Sequencing Primer
(F):5'- CCAGCACTGGCATTTGGTC -3'
(R):5'- TACACGTGATGTAGTCAGCCACTG -3'

Posted On

2019-06-26