Incidental Mutation 'R7219:Setbp1'
ID 561704
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene Name SET binding protein 1
Synonyms Seb
MMRRC Submission 045291-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.596) question?
Stock # R7219 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 78793595-79152606 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 78798960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 1407 (T1407P)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
AlphaFold Q9Z180
Predicted Effect probably damaging
Transcript: ENSMUST00000025430
AA Change: T1407P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: T1407P

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Meta Mutation Damage Score 0.1142 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,508 (GRCm39) S300P unknown Het
Abhd17a T A 10: 80,420,008 (GRCm39) K226* probably null Het
Alkbh7 T A 17: 57,305,508 (GRCm39) H108Q probably damaging Het
Ankrd44 A C 1: 54,806,069 (GRCm39) H112Q probably damaging Het
Capn3 A G 2: 120,333,935 (GRCm39) E790G probably damaging Het
Cd47 C A 16: 49,728,440 (GRCm39) N330K possibly damaging Het
Cd55 A G 1: 130,390,343 (GRCm39) S22P possibly damaging Het
Cdc25a A G 9: 109,718,154 (GRCm39) I373V probably damaging Het
Cfap43 T C 19: 47,779,912 (GRCm39) I514V probably benign Het
Cfap73 A T 5: 120,768,200 (GRCm39) M186K probably benign Het
Chd9 A G 8: 91,728,394 (GRCm39) D1270G unknown Het
Ciita A G 16: 10,330,121 (GRCm39) T802A probably benign Het
Dlgap2 A G 8: 14,793,296 (GRCm39) E430G probably benign Het
Dlx1 C A 2: 71,360,513 (GRCm39) S59* probably null Het
Dnaaf3 T C 7: 4,531,076 (GRCm39) N119S probably damaging Het
Dnah11 T G 12: 118,004,830 (GRCm39) I2164L possibly damaging Het
Dnah11 T C 12: 118,090,624 (GRCm39) K1079R probably benign Het
Dnah12 C T 14: 26,576,837 (GRCm39) T3029I probably damaging Het
Dppa3 A T 6: 122,606,918 (GRCm39) Y136F probably damaging Het
Enox1 T A 14: 77,958,284 (GRCm39) M611K probably benign Het
Fam149a A T 8: 45,803,600 (GRCm39) I378N possibly damaging Het
Farp2 T C 1: 93,488,040 (GRCm39) F89S probably damaging Het
Fbn2 C T 18: 58,186,099 (GRCm39) V1750M probably benign Het
Frs3 A G 17: 48,013,620 (GRCm39) T181A probably damaging Het
Heatr4 T A 12: 84,004,644 (GRCm39) I726F possibly damaging Het
Ighg1 T G 12: 113,290,216 (GRCm39) E375A Het
Ikzf4 G T 10: 128,470,252 (GRCm39) Q476K possibly damaging Het
Kcnh1 G T 1: 192,187,945 (GRCm39) C829F probably benign Het
Krtap19-4 T C 16: 88,681,797 (GRCm39) Y53C unknown Het
Loricrin C A 3: 91,988,705 (GRCm39) G194C unknown Het
Lrp1 A C 10: 127,393,097 (GRCm39) D2720E probably benign Het
Lrp4 A G 2: 91,322,368 (GRCm39) Y1068C probably damaging Het
Mbnl1 A G 3: 60,511,244 (GRCm39) N67D probably benign Het
Mrpl21 A G 19: 3,336,998 (GRCm39) E123G probably benign Het
Mst1 A T 9: 107,958,485 (GRCm39) D65V probably damaging Het
Myo15b T A 11: 115,767,921 (GRCm39) probably null Het
Myo5a A G 9: 75,028,052 (GRCm39) Y79C probably damaging Het
Oas1c A T 5: 120,940,957 (GRCm39) W279R probably damaging Het
Or4f4-ps1 A T 2: 111,330,532 (GRCm39) M312L probably benign Het
Or4k77 A T 2: 111,199,882 (GRCm39) I302L probably benign Het
Or51f5 A G 7: 102,430,913 (GRCm39) I77V probably benign Het
Pcdh9 C T 14: 93,253,216 (GRCm39) G1149D possibly damaging Het
Pcid2 G A 8: 13,129,907 (GRCm39) T283I probably benign Het
Pdhx A G 2: 102,858,760 (GRCm39) V348A probably benign Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Psmb3 T A 11: 97,602,023 (GRCm39) M131K probably null Het
Raph1 A G 1: 60,542,032 (GRCm39) Y309H unknown Het
Rasgrf1 A G 9: 89,866,341 (GRCm39) N593S probably damaging Het
Rbm38 A C 2: 172,863,990 (GRCm39) E53A possibly damaging Het
Rufy3 A G 5: 88,797,715 (GRCm39) T631A probably benign Het
Sbno1 A T 5: 124,543,722 (GRCm39) D272E probably benign Het
Scamp1 T A 13: 94,361,415 (GRCm39) Y207F probably damaging Het
Scn8a T A 15: 100,866,984 (GRCm39) S263R probably damaging Het
Skor2 T C 18: 76,948,096 (GRCm39) L606P possibly damaging Het
Slc35f6 A G 5: 30,814,796 (GRCm39) N241S probably benign Het
Slc36a2 T G 11: 55,059,744 (GRCm39) D247A probably benign Het
Smim10l1 T A 6: 133,084,895 (GRCm39) F87L unknown Het
Son T C 16: 91,461,889 (GRCm39) S2265P unknown Het
Spta1 A G 1: 174,050,203 (GRCm39) N1748D probably damaging Het
Sptbn2 A G 19: 4,774,201 (GRCm39) D84G probably damaging Het
Tasor2 T A 13: 3,640,521 (GRCm39) L205F probably damaging Het
Tbc1d24 G A 17: 24,404,266 (GRCm39) R293C probably damaging Het
Tex15 A G 8: 34,036,268 (GRCm39) T65A probably benign Het
Thyn1 A G 9: 26,916,506 (GRCm39) Y97C probably damaging Het
Tmem64 T C 4: 15,266,700 (GRCm39) L250P probably damaging Het
Tnfrsf9 A T 4: 151,019,991 (GRCm39) K217N probably damaging Het
Tnxb A G 17: 34,898,039 (GRCm39) T896A probably benign Het
Trpm1 T A 7: 63,854,333 (GRCm39) I285N possibly damaging Het
Try5 T A 6: 41,288,637 (GRCm39) D194V probably damaging Het
U2surp G A 9: 95,372,215 (GRCm39) R316* probably null Het
Ubr2 G T 17: 47,246,360 (GRCm39) S1618* probably null Het
Ugp2 T C 11: 21,273,271 (GRCm39) I449M probably damaging Het
Umodl1 A G 17: 31,201,236 (GRCm39) probably null Het
Vmn2r31 C T 7: 7,390,105 (GRCm39) V538I probably benign Het
Vmn2r31 A T 7: 7,397,397 (GRCm39) M287K probably damaging Het
Wwc2 A G 8: 48,311,919 (GRCm39) V748A unknown Het
Zfp800 A C 6: 28,243,662 (GRCm39) H434Q probably benign Het
Zfp869 A G 8: 70,159,356 (GRCm39) C406R probably damaging Het
Zhx1 A G 15: 57,917,733 (GRCm39) V171A probably benign Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78,798,894 (GRCm39) nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78,900,985 (GRCm39) missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78,899,992 (GRCm39) missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78,900,625 (GRCm39) missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78,900,514 (GRCm39) missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78,900,688 (GRCm39) missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78,798,925 (GRCm39) missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78,900,589 (GRCm39) nonsense probably null
IGL03005:Setbp1 APN 18 78,902,340 (GRCm39) missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78,900,224 (GRCm39) missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78,900,841 (GRCm39) missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78,901,075 (GRCm39) missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78,900,451 (GRCm39) missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78,899,798 (GRCm39) missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78,901,423 (GRCm39) missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78,826,573 (GRCm39) missense probably benign 0.00
R1481:Setbp1 UTSW 18 78,826,516 (GRCm39) missense probably benign 0.01
R1482:Setbp1 UTSW 18 79,130,050 (GRCm39) missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78,903,127 (GRCm39) missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78,901,807 (GRCm39) missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78,901,682 (GRCm39) missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78,900,613 (GRCm39) missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78,901,577 (GRCm39) missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78,901,759 (GRCm39) missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78,899,935 (GRCm39) missense probably benign 0.00
R2851:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2853:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2941:Setbp1 UTSW 18 78,901,412 (GRCm39) missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78,900,650 (GRCm39) missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78,902,518 (GRCm39) missense probably benign 0.00
R3807:Setbp1 UTSW 18 78,826,537 (GRCm39) missense probably benign 0.01
R4133:Setbp1 UTSW 18 78,900,206 (GRCm39) missense probably benign 0.05
R4287:Setbp1 UTSW 18 78,902,276 (GRCm39) missense probably benign 0.03
R4345:Setbp1 UTSW 18 79,129,794 (GRCm39) missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78,899,833 (GRCm39) missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79,129,896 (GRCm39) missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79,130,164 (GRCm39) missense probably benign 0.00
R4595:Setbp1 UTSW 18 78,900,731 (GRCm39) missense probably benign 0.00
R4817:Setbp1 UTSW 18 78,902,015 (GRCm39) missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78,901,382 (GRCm39) missense probably benign 0.07
R4976:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78,899,809 (GRCm39) missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78,900,514 (GRCm39) missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78,900,697 (GRCm39) missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78,901,214 (GRCm39) missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78,900,190 (GRCm39) missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78,901,278 (GRCm39) missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79,129,867 (GRCm39) missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78,900,700 (GRCm39) missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78,899,860 (GRCm39) missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78,899,697 (GRCm39) splice site probably null
R5940:Setbp1 UTSW 18 78,798,703 (GRCm39) missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78,902,455 (GRCm39) missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6250:Setbp1 UTSW 18 78,901,217 (GRCm39) missense probably benign 0.00
R6256:Setbp1 UTSW 18 78,900,472 (GRCm39) missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78,826,584 (GRCm39) missense probably benign 0.21
R6522:Setbp1 UTSW 18 78,900,605 (GRCm39) missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78,902,774 (GRCm39) missense probably benign 0.00
R6886:Setbp1 UTSW 18 78,900,715 (GRCm39) missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78,901,054 (GRCm39) missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79,130,070 (GRCm39) missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79,130,175 (GRCm39) missense probably benign 0.08
R7134:Setbp1 UTSW 18 78,902,734 (GRCm39) missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78,900,052 (GRCm39) missense probably damaging 0.97
R7378:Setbp1 UTSW 18 78,900,701 (GRCm39) missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.06
R7589:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.01
R7840:Setbp1 UTSW 18 78,826,639 (GRCm39) missense probably benign 0.03
R7849:Setbp1 UTSW 18 78,900,068 (GRCm39) missense probably benign 0.00
R8147:Setbp1 UTSW 18 78,900,015 (GRCm39) missense probably damaging 1.00
R8354:Setbp1 UTSW 18 78,900,598 (GRCm39) missense probably damaging 1.00
R8446:Setbp1 UTSW 18 78,900,971 (GRCm39) missense probably damaging 1.00
R8524:Setbp1 UTSW 18 78,901,969 (GRCm39) missense probably damaging 1.00
R8534:Setbp1 UTSW 18 78,826,542 (GRCm39) missense possibly damaging 0.86
R8694:Setbp1 UTSW 18 78,901,516 (GRCm39) missense probably damaging 1.00
R8931:Setbp1 UTSW 18 78,899,723 (GRCm39) missense probably benign 0.00
R8983:Setbp1 UTSW 18 78,902,459 (GRCm39) missense probably benign 0.37
R9062:Setbp1 UTSW 18 78,900,266 (GRCm39) missense probably benign 0.01
R9113:Setbp1 UTSW 18 78,900,948 (GRCm39) missense probably damaging 0.99
R9364:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9513:Setbp1 UTSW 18 78,899,781 (GRCm39) missense probably damaging 1.00
R9517:Setbp1 UTSW 18 78,901,322 (GRCm39) missense probably damaging 0.99
R9549:Setbp1 UTSW 18 78,902,629 (GRCm39) missense probably benign 0.07
R9554:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9680:Setbp1 UTSW 18 78,902,498 (GRCm39) missense probably benign
R9711:Setbp1 UTSW 18 78,900,142 (GRCm39) missense probably benign 0.30
Z1088:Setbp1 UTSW 18 78,902,809 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGTAGGTCAATGCACTTTTCCAG -3'
(R):5'- TGCTTTGTACACGTGATGTAGTCAG -3'

Sequencing Primer
(F):5'- CCAGCACTGGCATTTGGTC -3'
(R):5'- TACACGTGATGTAGTCAGCCACTG -3'
Posted On 2019-06-26