Incidental Mutation 'R7219:Cfap43'
ID561707
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Namecilia and flagella associated protein 43
Synonyms4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96
MMRRC Submission
Accession Numbers

Genbank: NM_027559

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7219 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location47737561-47919299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47791473 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 514 (I514V)
Ref Sequence ENSEMBL: ENSMUSP00000125007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160247]
Predicted Effect probably benign
Transcript: ENSMUST00000160247
AA Change: I514V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948
AA Change: I514V

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Blast:WD40 70 111 6e-7 BLAST
Blast:WD40 115 156 1e-5 BLAST
Blast:WD40 162 197 8e-10 BLAST
WD40 349 388 1.07e0 SMART
Blast:WD40 392 432 3e-13 BLAST
WD40 435 473 3.96e1 SMART
WD40 479 518 3.82e1 SMART
Blast:WD40 638 683 8e-17 BLAST
Blast:WD40 689 728 1e-17 BLAST
low complexity region 766 781 N/A INTRINSIC
coiled coil region 855 886 N/A INTRINSIC
coiled coil region 925 961 N/A INTRINSIC
low complexity region 971 981 N/A INTRINSIC
coiled coil region 1170 1224 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
low complexity region 1268 1279 N/A INTRINSIC
low complexity region 1524 1529 N/A INTRINSIC
coiled coil region 1652 1671 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,644 S300P unknown Het
Abhd17a T A 10: 80,584,174 K226* probably null Het
Alkbh7 T A 17: 56,998,508 H108Q probably damaging Het
Ankrd44 A C 1: 54,766,910 H112Q probably damaging Het
Capn3 A G 2: 120,503,454 E790G probably damaging Het
Cd47 C A 16: 49,908,077 N330K possibly damaging Het
Cd55 A G 1: 130,462,606 S22P possibly damaging Het
Cdc25a A G 9: 109,889,086 I373V probably damaging Het
Cfap73 A T 5: 120,630,135 M186K probably benign Het
Chd9 A G 8: 91,001,766 D1270G unknown Het
Ciita A G 16: 10,512,257 T802A probably benign Het
Dlgap2 A G 8: 14,743,296 E430G probably benign Het
Dlx1 C A 2: 71,530,169 S59* probably null Het
Dnaaf3 T C 7: 4,528,077 N119S probably damaging Het
Dnah11 T G 12: 118,041,095 I2164L possibly damaging Het
Dnah11 T C 12: 118,126,889 K1079R probably benign Het
Dnah12 C T 14: 26,854,880 T3029I probably damaging Het
Dppa3 A T 6: 122,629,959 Y136F probably damaging Het
Enox1 T A 14: 77,720,844 M611K probably benign Het
Fam149a A T 8: 45,350,563 I378N possibly damaging Het
Fam208b T A 13: 3,590,521 L205F probably damaging Het
Farp2 T C 1: 93,560,318 F89S probably damaging Het
Fbn2 C T 18: 58,053,027 V1750M probably benign Het
Frs3 A G 17: 47,702,695 T181A probably damaging Het
Heatr4 T A 12: 83,957,870 I726F possibly damaging Het
Ighg1 T G 12: 113,326,596 E375A Het
Ikzf4 G T 10: 128,634,383 Q476K possibly damaging Het
Kcnh1 G T 1: 192,505,637 C829F probably benign Het
Krtap19-4 T C 16: 88,884,909 Y53C unknown Het
Lor C A 3: 92,081,398 G194C unknown Het
Lrp1 A C 10: 127,557,228 D2720E probably benign Het
Lrp4 A G 2: 91,492,023 Y1068C probably damaging Het
Mbnl1 A G 3: 60,603,823 N67D probably benign Het
Mrpl21 A G 19: 3,286,998 E123G probably benign Het
Mst1 A T 9: 108,081,286 D65V probably damaging Het
Myo15b T A 11: 115,877,095 probably null Het
Myo5a A G 9: 75,120,770 Y79C probably damaging Het
Oas1c A T 5: 120,802,892 W279R probably damaging Het
Olfr1283 A T 2: 111,369,537 I302L probably benign Het
Olfr1291-ps1 A T 2: 111,500,187 M312L probably benign Het
Olfr561 A G 7: 102,781,706 I77V probably benign Het
Pcdh9 C T 14: 93,015,780 G1149D possibly damaging Het
Pcid2 G A 8: 13,079,907 T283I probably benign Het
Pdhx A G 2: 103,028,415 V348A probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmb3 T A 11: 97,711,197 M131K probably null Het
Raph1 A G 1: 60,502,873 Y309H unknown Het
Rasgrf1 A G 9: 89,984,288 N593S probably damaging Het
Rbm38 A C 2: 173,022,197 E53A possibly damaging Het
Rufy3 A G 5: 88,649,856 T631A probably benign Het
Sbno1 A T 5: 124,405,659 D272E probably benign Het
Scamp1 T A 13: 94,224,907 Y207F probably damaging Het
Scn8a T A 15: 100,969,103 S263R probably damaging Het
Setbp1 T G 18: 78,755,745 T1407P probably damaging Het
Skor2 T C 18: 76,860,401 L606P possibly damaging Het
Slc35f6 A G 5: 30,657,452 N241S probably benign Het
Slc36a2 T G 11: 55,168,918 D247A probably benign Het
Smim10l1 T A 6: 133,107,932 F87L unknown Het
Son T C 16: 91,665,001 S2265P unknown Het
Spta1 A G 1: 174,222,637 N1748D probably damaging Het
Sptbn2 A G 19: 4,724,173 D84G probably damaging Het
Tbc1d24 G A 17: 24,185,292 R293C probably damaging Het
Tex15 A G 8: 33,546,240 T65A probably benign Het
Thyn1 A G 9: 27,005,210 Y97C probably damaging Het
Tmem64 T C 4: 15,266,700 L250P probably damaging Het
Tnfrsf9 A T 4: 150,935,534 K217N probably damaging Het
Tnxb A G 17: 34,679,065 T896A probably benign Het
Trpm1 T A 7: 64,204,585 I285N possibly damaging Het
Try5 T A 6: 41,311,703 D194V probably damaging Het
U2surp G A 9: 95,490,162 R316* probably null Het
Ubr2 G T 17: 46,935,434 S1618* probably null Het
Ugp2 T C 11: 21,323,271 I449M probably damaging Het
Umodl1 A G 17: 30,982,262 probably null Het
Vmn2r31 C T 7: 7,387,106 V538I probably benign Het
Vmn2r31 A T 7: 7,394,398 M287K probably damaging Het
Wwc2 A G 8: 47,858,884 V748A unknown Het
Zfp800 A C 6: 28,243,663 H434Q probably benign Het
Zfp869 A G 8: 69,706,706 C406R probably damaging Het
Zhx1 A G 15: 58,054,337 V171A probably benign Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47830475 missense probably benign 0.08
IGL00325:Cfap43 APN 19 47823188 splice site probably benign
IGL00918:Cfap43 APN 19 47896661 missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01404:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01656:Cfap43 APN 19 47751900 missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47797185 missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47751923 splice site probably benign
IGL02225:Cfap43 APN 19 47812177 missense probably benign 0.00
IGL02308:Cfap43 APN 19 47748024 missense probably benign
IGL02354:Cfap43 APN 19 47897413 nonsense probably null
IGL02361:Cfap43 APN 19 47897413 nonsense probably null
IGL03283:Cfap43 APN 19 47791412 splice site probably benign
3-1:Cfap43 UTSW 19 47751855 missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47815863 missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47897302 missense probably damaging 1.00
R0270:Cfap43 UTSW 19 47797203 splice site probably benign
R0421:Cfap43 UTSW 19 47835575 missense probably benign 0.00
R0433:Cfap43 UTSW 19 47825771 missense probably benign 0.44
R0576:Cfap43 UTSW 19 47797140 missense probably benign 0.00
R0646:Cfap43 UTSW 19 47763676 missense probably benign 0.25
R0740:Cfap43 UTSW 19 47835804 missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47815846 missense probably benign 0.02
R0899:Cfap43 UTSW 19 47747994 missense possibly damaging 0.93
R1171:Cfap43 UTSW 19 47835711 missense probably benign 0.03
R1271:Cfap43 UTSW 19 47739744 missense probably benign 0.22
R1271:Cfap43 UTSW 19 47747948 missense probably damaging 0.98
R1371:Cfap43 UTSW 19 47835606 missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47896875 missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47763852 splice site probably null
R1625:Cfap43 UTSW 19 47751088 missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47773114 missense probably benign 0.00
R1690:Cfap43 UTSW 19 47751066 critical splice donor site probably null
R1820:Cfap43 UTSW 19 47897216 missense probably damaging 0.99
R1891:Cfap43 UTSW 19 47813941 missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R1958:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R2110:Cfap43 UTSW 19 47835758 missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47770438 missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47773135 missense probably damaging 0.99
R3691:Cfap43 UTSW 19 47897073 missense probably benign 0.01
R3765:Cfap43 UTSW 19 47835575 missense probably benign 0.01
R3917:Cfap43 UTSW 19 47897750 missense probably benign 0.00
R3924:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3925:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3947:Cfap43 UTSW 19 47765979 missense probably benign 0.28
R4256:Cfap43 UTSW 19 47782405 missense probably benign 0.06
R4385:Cfap43 UTSW 19 47797129 missense probably benign 0.28
R4395:Cfap43 UTSW 19 47751913 missense probably benign 0.00
R4405:Cfap43 UTSW 19 47739797 missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47748015 missense probably benign 0.02
R4583:Cfap43 UTSW 19 47837216 missense probably null 0.99
R4690:Cfap43 UTSW 19 47747859 missense probably benign 0.45
R4852:Cfap43 UTSW 19 47897111 missense possibly damaging 0.87
R5185:Cfap43 UTSW 19 47780394 missense probably benign 0.00
R5192:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47897372 missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47897548 missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47896932 missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47738209 intron probably null
R5644:Cfap43 UTSW 19 47795675 missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47795696 missense probably benign
R5901:Cfap43 UTSW 19 47897099 missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47780271 missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47760896 missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47745574 missense probably benign 0.42
R6817:Cfap43 UTSW 19 47756085 missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47785278 critical splice donor site probably null
R7270:Cfap43 UTSW 19 47739785 missense possibly damaging 0.86
R7733:Cfap43 UTSW 19 47897993 missense possibly damaging 0.75
R7995:Cfap43 UTSW 19 47898023 missense probably damaging 1.00
R8013:Cfap43 UTSW 19 47773109 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGGTTGTAAGCCATCTGTTC -3'
(R):5'- ATGATGCCACCCACGCTAAG -3'

Sequencing Primer
(F):5'- TCAATAGTTGATACAAGGGTTGTTG -3'
(R):5'- CACGCTAAGAGTGGCTGG -3'
Posted On2019-06-26