Incidental Mutation 'R7220:Ckmt1'
ID561713
Institutional Source Beutler Lab
Gene Symbol Ckmt1
Ensembl Gene ENSMUSG00000000308
Gene Namecreatine kinase, mitochondrial 1, ubiquitous
Synonymsmi-CK, UbCKmit, Mt-CK
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R7220 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121357714-121363737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121358893 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 15 (L15P)
Ref Sequence ENSEMBL: ENSMUSP00000000317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000110625] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000125221] [ENSMUST00000125812] [ENSMUST00000126130] [ENSMUST00000128612] [ENSMUST00000129130] [ENSMUST00000134796] [ENSMUST00000150271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000317
AA Change: L15P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308
AA Change: L15P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 58 133 5.8e-34 PFAM
Pfam:ATP-gua_Ptrans 154 401 4.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038389
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078222
AA Change: L15P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308
AA Change: L15P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 1.2e-37 PFAM
Pfam:ATP-gua_Ptrans 154 401 2e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110625
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110627
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110628
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125221
AA Change: L15P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121930
Gene: ENSMUSG00000000308
AA Change: L15P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 117 5.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125812
AA Change: L15P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115501
Gene: ENSMUSG00000000308
AA Change: L15P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 9.7e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000126130
AA Change: L15P
SMART Domains Protein: ENSMUSP00000117463
Gene: ENSMUSG00000000308
AA Change: L15P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128612
AA Change: L15P
SMART Domains Protein: ENSMUSP00000115610
Gene: ENSMUSG00000000308
AA Change: L15P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129130
AA Change: L15P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123130
Gene: ENSMUSG00000000308
AA Change: L15P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 86 165 5.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134796
Predicted Effect possibly damaging
Transcript: ENSMUST00000150271
AA Change: L15P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120507
Gene: ENSMUSG00000000308
AA Change: L15P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 3.3e-38 PFAM
Pfam:ATP-gua_Ptrans 154 251 3.8e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have no visual or motor impairments but display diminished open field habituation and slower spatial learning acquisition in the Morris water maze task as well as a reduced acoustic startle response, higher threshold, and lack of prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gkn1 A T 6: 87,349,153 probably null Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Ckmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Ckmt1 APN 2 121361150 missense probably damaging 1.00
IGL01141:Ckmt1 APN 2 121362993 missense probably benign 0.07
IGL01403:Ckmt1 APN 2 121362966 unclassified probably benign
IGL01971:Ckmt1 APN 2 121363583 missense probably benign 0.41
IGL02037:Ckmt1 APN 2 121361162 missense probably damaging 0.99
IGL02750:Ckmt1 APN 2 121363615 unclassified probably benign
IGL03303:Ckmt1 APN 2 121360005 missense probably benign
R0157:Ckmt1 UTSW 2 121363041 missense possibly damaging 0.86
R0331:Ckmt1 UTSW 2 121362856 unclassified probably null
R1590:Ckmt1 UTSW 2 121363522 missense possibly damaging 0.96
R1640:Ckmt1 UTSW 2 121359717 unclassified probably null
R1853:Ckmt1 UTSW 2 121360650 missense probably damaging 1.00
R4726:Ckmt1 UTSW 2 121361231 critical splice donor site probably null
R4788:Ckmt1 UTSW 2 121359946 missense possibly damaging 0.87
R5632:Ckmt1 UTSW 2 121360592 missense probably damaging 1.00
R5633:Ckmt1 UTSW 2 121363629 unclassified probably benign
R5960:Ckmt1 UTSW 2 121363577 missense probably damaging 1.00
R6123:Ckmt1 UTSW 2 121363579 missense probably benign 0.05
R6673:Ckmt1 UTSW 2 121359670 missense probably damaging 1.00
X0067:Ckmt1 UTSW 2 121360967 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTTCAGCCTTCATCGTGAC -3'
(R):5'- GGAAATCCATCTTCGAGGCC -3'

Sequencing Primer
(F):5'- GTGACCCCTATTTTGGCTCCAG -3'
(R):5'- CGAGGCCTATCTTTTGCTCAGG -3'
Posted On2019-06-26