Incidental Mutation 'R7220:Tlr4'
ID561719
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7220 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66839951 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 327 (H327L)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
PDB Structure Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048096
AA Change: H327L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: H327L

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gkn1 A T 6: 87,349,153 probably null Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 splice site probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 critical splice donor site probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
Cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
salvador UTSW 4 66840206 missense probably damaging 0.99
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
R7139:Tlr4 UTSW 4 66840283 missense probably benign 0.06
R7199:Tlr4 UTSW 4 66841193 missense probably damaging 0.99
R7337:Tlr4 UTSW 4 66839954 missense possibly damaging 0.86
R7487:Tlr4 UTSW 4 66924422 missense probably benign 0.00
R7638:Tlr4 UTSW 4 66840206 missense probably damaging 0.99
R7773:Tlr4 UTSW 4 66839599 missense probably damaging 1.00
R7814:Tlr4 UTSW 4 66841079 missense probably damaging 1.00
R7897:Tlr4 UTSW 4 66839821 missense probably benign 0.07
R8044:Tlr4 UTSW 4 66827847 missense probably benign 0.01
R8062:Tlr4 UTSW 4 66839850 missense probably benign 0.00
R8080:Tlr4 UTSW 4 66839476 missense probably damaging 1.00
R8446:Tlr4 UTSW 4 66839436 missense probably damaging 0.98
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACGTCCATCGGTTGATCTTG -3'
(R):5'- GCAACCACTAAAGCTCAGTG -3'

Sequencing Primer
(F):5'- GGAATCTGGAAATTTTTGAACCCTC -3'
(R):5'- GCTCAGTGCATTTCTACTAAGATC -3'
Posted On2019-06-26