Incidental Mutation 'R7220:Vmn2r16'
ID561727
Institutional Source Beutler Lab
Gene Symbol Vmn2r16
Ensembl Gene ENSMUSG00000092080
Gene Namevomeronasal 2, receptor 16
SynonymsEG384220
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R7220 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109330381-109364481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109360906 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 500 (E500G)
Ref Sequence ENSEMBL: ENSMUSP00000127838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165180]
Predicted Effect probably damaging
Transcript: ENSMUST00000165180
AA Change: E500G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127838
Gene: ENSMUSG00000092080
AA Change: E500G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.3e-28 PFAM
Pfam:NCD3G 509 563 8.2e-19 PFAM
Pfam:7tm_3 596 831 3.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gkn1 A T 6: 87,349,153 probably null Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Vmn2r16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Vmn2r16 APN 5 109340428 missense probably damaging 1.00
IGL01374:Vmn2r16 APN 5 109330417 missense probably benign 0.00
IGL01391:Vmn2r16 APN 5 109363761 missense possibly damaging 0.50
IGL01419:Vmn2r16 APN 5 109362401 splice site probably benign
IGL01634:Vmn2r16 APN 5 109340311 missense probably benign 0.00
IGL01845:Vmn2r16 APN 5 109363896 missense probably damaging 1.00
IGL01875:Vmn2r16 APN 5 109330411 missense probably benign 0.01
IGL01910:Vmn2r16 APN 5 109340085 missense probably damaging 1.00
IGL02217:Vmn2r16 APN 5 109339810 missense probably damaging 0.98
IGL02327:Vmn2r16 APN 5 109340121 missense probably benign 0.01
IGL02491:Vmn2r16 APN 5 109339837 nonsense probably null
IGL02531:Vmn2r16 APN 5 109340268 missense probably damaging 0.99
IGL02680:Vmn2r16 APN 5 109340082 missense probably benign 0.44
IGL02884:Vmn2r16 APN 5 109360891 missense possibly damaging 0.94
IGL03084:Vmn2r16 APN 5 109330426 missense probably damaging 0.99
IGL03096:Vmn2r16 APN 5 109339885 missense probably damaging 0.99
IGL03355:Vmn2r16 APN 5 109363714 missense possibly damaging 0.74
R0280:Vmn2r16 UTSW 5 109340139 missense possibly damaging 0.88
R0594:Vmn2r16 UTSW 5 109363896 missense probably damaging 1.00
R1016:Vmn2r16 UTSW 5 109339888 missense probably damaging 1.00
R1109:Vmn2r16 UTSW 5 109339786 missense probably damaging 0.98
R1248:Vmn2r16 UTSW 5 109360777 missense probably benign 0.10
R1626:Vmn2r16 UTSW 5 109363577 missense probably damaging 1.00
R1909:Vmn2r16 UTSW 5 109363987 missense probably benign 0.01
R1929:Vmn2r16 UTSW 5 109339258 missense possibly damaging 0.92
R1982:Vmn2r16 UTSW 5 109364024 missense probably benign 0.01
R3038:Vmn2r16 UTSW 5 109339333 missense probably damaging 1.00
R3437:Vmn2r16 UTSW 5 109330496 missense probably damaging 0.99
R3734:Vmn2r16 UTSW 5 109330414 missense probably benign 0.11
R3820:Vmn2r16 UTSW 5 109362277 missense probably benign 0.36
R3873:Vmn2r16 UTSW 5 109340311 missense probably benign 0.33
R4165:Vmn2r16 UTSW 5 109330561 missense possibly damaging 0.80
R4373:Vmn2r16 UTSW 5 109363801 missense probably damaging 1.00
R4575:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4576:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4578:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4637:Vmn2r16 UTSW 5 109330414 missense probably benign 0.00
R4696:Vmn2r16 UTSW 5 109339302 missense probably benign 0.01
R5026:Vmn2r16 UTSW 5 109360856 nonsense probably null
R5180:Vmn2r16 UTSW 5 109330525 missense probably benign 0.01
R5433:Vmn2r16 UTSW 5 109363842 missense probably damaging 1.00
R5955:Vmn2r16 UTSW 5 109363747 missense possibly damaging 0.78
R5958:Vmn2r16 UTSW 5 109362287 missense possibly damaging 0.81
R6353:Vmn2r16 UTSW 5 109340253 missense probably benign 0.33
R6389:Vmn2r16 UTSW 5 109330478 missense probably benign 0.19
R6819:Vmn2r16 UTSW 5 109340546 missense probably benign 0.04
R6994:Vmn2r16 UTSW 5 109340103 missense probably damaging 1.00
R7061:Vmn2r16 UTSW 5 109363754 missense probably damaging 0.99
R7063:Vmn2r16 UTSW 5 109363784 missense probably damaging 1.00
R7268:Vmn2r16 UTSW 5 109340465 nonsense probably null
R7420:Vmn2r16 UTSW 5 109363870 missense probably damaging 0.96
R7591:Vmn2r16 UTSW 5 109362357 missense probably damaging 0.99
R7644:Vmn2r16 UTSW 5 109339971 missense probably damaging 1.00
X0027:Vmn2r16 UTSW 5 109339309 missense probably damaging 1.00
Z1088:Vmn2r16 UTSW 5 109340515 missense probably benign 0.03
Z1088:Vmn2r16 UTSW 5 109363913 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGTTGGAGAACTGGT -3'
(R):5'- AATGTGTTTCTGTACTGTGGATTGAA -3'

Sequencing Primer
(F):5'- CCTGTTGGAGAACTGGTGAACATG -3'
(R):5'- TCCAATAGCTGACTGTGAGC -3'
Posted On2019-06-26