Incidental Mutation 'R7220:Ints1'
ID561728
Institutional Source Beutler Lab
Gene Symbol Ints1
Ensembl Gene ENSMUSG00000029547
Gene Nameintegrator complex subunit 1
Synonyms1110015K06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026748; MGI: 1915760

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7220 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location139751282-139775674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139762073 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1193 (I1193N)
Ref Sequence ENSEMBL: ENSMUSP00000143789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072607] [ENSMUST00000200393]
Predicted Effect
SMART Domains Protein: ENSMUSP00000072406
Gene: ENSMUSG00000029547
AA Change: I1191N

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200393
AA Change: I1193N

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143789
Gene: ENSMUSG00000029547
AA Change: I1193N

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(9)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gkn1 A T 6: 87,349,153 probably null Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Ints1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ints1 APN 5 139771682 missense probably damaging 0.99
IGL01329:Ints1 APN 5 139767503 splice site probably benign
IGL01414:Ints1 APN 5 139758498 missense probably benign
IGL01612:Ints1 APN 5 139756292 missense probably benign 0.17
IGL01726:Ints1 APN 5 139768411 splice site probably benign
IGL01958:Ints1 APN 5 139760088 missense possibly damaging 0.94
IGL02122:Ints1 APN 5 139765150 nonsense probably null
IGL02149:Ints1 APN 5 139751960 missense probably damaging 1.00
IGL02349:Ints1 APN 5 139768468 missense probably damaging 0.96
IGL02557:Ints1 APN 5 139771637 missense probably damaging 1.00
IGL02814:Ints1 APN 5 139772391 missense possibly damaging 0.80
IGL02815:Ints1 APN 5 139755282 missense probably damaging 0.96
IGL02825:Ints1 APN 5 139764739 missense probably benign 0.32
IGL03000:Ints1 APN 5 139766506 missense probably benign 0.01
IGL03164:Ints1 APN 5 139752735 missense probably damaging 0.99
A9681:Ints1 UTSW 5 139770139 missense possibly damaging 0.56
R0113:Ints1 UTSW 5 139765213 missense probably benign 0.01
R0193:Ints1 UTSW 5 139751730 missense probably damaging 1.00
R0372:Ints1 UTSW 5 139772438 missense probably damaging 1.00
R1129:Ints1 UTSW 5 139758471 missense probably benign 0.00
R1290:Ints1 UTSW 5 139771410 nonsense probably null
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1691:Ints1 UTSW 5 139768932 missense probably damaging 1.00
R1708:Ints1 UTSW 5 139762839 missense probably damaging 1.00
R1791:Ints1 UTSW 5 139774522 missense probably benign 0.04
R2066:Ints1 UTSW 5 139767496 missense probably benign 0.14
R2102:Ints1 UTSW 5 139755999 missense possibly damaging 0.50
R2108:Ints1 UTSW 5 139767750 missense probably damaging 1.00
R2238:Ints1 UTSW 5 139765200 missense possibly damaging 0.95
R2426:Ints1 UTSW 5 139771814 critical splice donor site probably null
R2913:Ints1 UTSW 5 139757913 missense possibly damaging 0.91
R3896:Ints1 UTSW 5 139757644 nonsense probably null
R4608:Ints1 UTSW 5 139759844 missense probably benign 0.13
R4658:Ints1 UTSW 5 139774299 missense possibly damaging 0.88
R4797:Ints1 UTSW 5 139771876 missense possibly damaging 0.85
R4887:Ints1 UTSW 5 139771156 missense possibly damaging 0.66
R4944:Ints1 UTSW 5 139758092 splice site probably null
R4956:Ints1 UTSW 5 139757130 missense probably damaging 1.00
R4976:Ints1 UTSW 5 139752811 missense probably damaging 1.00
R5283:Ints1 UTSW 5 139764382 missense probably damaging 1.00
R5354:Ints1 UTSW 5 139766428 critical splice donor site probably null
R5496:Ints1 UTSW 5 139755198 missense probably benign 0.07
R5517:Ints1 UTSW 5 139752787 missense possibly damaging 0.86
R5696:Ints1 UTSW 5 139754989 missense probably benign 0.00
R5766:Ints1 UTSW 5 139772145 missense probably benign 0.33
R6359:Ints1 UTSW 5 139756217 missense probably benign 0.09
R6753:Ints1 UTSW 5 139765175 missense probably damaging 1.00
R6892:Ints1 UTSW 5 139767828 missense probably damaging 0.99
R7009:Ints1 UTSW 5 139768462 missense possibly damaging 0.83
R7047:Ints1 UTSW 5 139758471 nonsense probably null
R7216:Ints1 UTSW 5 139768984 missense possibly damaging 0.91
R7263:Ints1 UTSW 5 139764079 missense possibly damaging 0.50
R7291:Ints1 UTSW 5 139765074 missense probably damaging 1.00
R7319:Ints1 UTSW 5 139760765 missense probably damaging 1.00
R7411:Ints1 UTSW 5 139764260 missense possibly damaging 0.54
R7497:Ints1 UTSW 5 139768976 missense probably damaging 0.99
R7529:Ints1 UTSW 5 139767726 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CACTCTCTTAGGCATAAAGGGAAC -3'
(R):5'- TCTGAGGTGGACTGAAGCAG -3'

Sequencing Primer
(F):5'- AACCTGTACTGACCAGGGGTTTC -3'
(R):5'- CTGAAGCAGGCAGGGCAC -3'
Posted On2019-06-26