Incidental Mutation 'R7220:Abca14'
ID 561736
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 045292-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7220 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119826667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 438 (D438N)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect possibly damaging
Transcript: ENSMUST00000084640
AA Change: D438N

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: D438N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,837,337 (GRCm39) H325Q probably damaging Het
Aasdh T C 5: 77,049,772 (GRCm39) I75V probably benign Het
Abca8a T A 11: 109,980,793 (GRCm39) I82F probably benign Het
Abca8b G T 11: 109,872,543 (GRCm39) N19K probably damaging Het
Acan A G 7: 78,757,896 (GRCm39) N506S Het
Alox12e C A 11: 70,206,731 (GRCm39) R652L probably benign Het
Atad3a A G 4: 155,838,498 (GRCm39) V173A probably benign Het
Atl3 A G 19: 7,506,433 (GRCm39) K326R probably null Het
Atm G T 9: 53,423,217 (GRCm39) C636* probably null Het
Atp2c2 G A 8: 120,472,300 (GRCm39) M451I probably benign Het
Best1 A T 19: 9,969,479 (GRCm39) M193K probably benign Het
Bmper G T 9: 23,310,651 (GRCm39) G362C probably damaging Het
Brd4 T A 17: 32,444,557 (GRCm39) Y139F unknown Het
Bzw2 A T 12: 36,173,950 (GRCm39) I108N possibly damaging Het
Cbs C A 17: 31,838,191 (GRCm39) V353L probably benign Het
Ceacam20 A G 7: 19,701,678 (GRCm39) T22A probably damaging Het
Ckap2l C T 2: 129,117,436 (GRCm39) E580K probably damaging Het
Ckmt1 T C 2: 121,189,374 (GRCm39) L15P possibly damaging Het
Clec18a G T 8: 111,808,204 (GRCm39) P66H probably benign Het
Cma1 G T 14: 56,180,120 (GRCm39) T95K probably benign Het
Csmd3 A G 15: 48,320,994 (GRCm39) V272A probably damaging Het
Ctnna3 A T 10: 64,670,368 (GRCm39) E632D probably benign Het
Ctsc T C 7: 87,946,361 (GRCm39) L130P probably damaging Het
Frmpd2 A T 14: 33,229,432 (GRCm39) R339S probably damaging Het
Frrs1 C A 3: 116,674,425 (GRCm39) S69* probably null Het
Gcc2 A T 10: 58,116,416 (GRCm39) E1108D probably benign Het
Gkn1 A T 6: 87,326,135 (GRCm39) probably null Het
Gtf2a1 A T 12: 91,534,498 (GRCm39) M252K probably benign Het
H2-Ob T C 17: 34,460,234 (GRCm39) F115S probably damaging Het
Ighv1-53 T C 12: 115,122,135 (GRCm39) N80S probably benign Het
Ighv1-67 T C 12: 115,567,666 (GRCm39) K82R probably benign Het
Ints1 A T 5: 139,747,828 (GRCm39) I1193N possibly damaging Het
Kmt2c A G 5: 25,549,923 (GRCm39) F1353L probably damaging Het
Luc7l C T 17: 26,472,219 (GRCm39) probably benign Het
Man1a A C 10: 53,796,331 (GRCm39) S454A possibly damaging Het
Mars2 C A 1: 55,277,222 (GRCm39) A275D probably damaging Het
Nrde2 A G 12: 100,097,178 (GRCm39) V874A probably benign Het
Ociad1 A G 5: 73,470,809 (GRCm39) T244A probably benign Het
Or10j2 A G 1: 173,097,811 (GRCm39) Y23C possibly damaging Het
Or3a10 A T 11: 73,935,589 (GRCm39) D170E possibly damaging Het
Or8c9 A T 9: 38,241,046 (GRCm39) L51F probably damaging Het
Ovca2 A G 11: 75,069,501 (GRCm39) C41R possibly damaging Het
Pacsin2 A T 15: 83,269,260 (GRCm39) D11E probably damaging Het
Pcdh15 G A 10: 74,178,441 (GRCm39) S566N possibly damaging Het
Pde3b A G 7: 114,135,297 (GRCm39) I1038M probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pkhd1 T A 1: 20,593,350 (GRCm39) T1588S possibly damaging Het
Ppig A G 2: 69,580,320 (GRCm39) D618G unknown Het
Pramel17 A G 4: 101,694,565 (GRCm39) F106S probably benign Het
Prorp G A 12: 55,351,200 (GRCm39) V170M possibly damaging Het
Prss51 A T 14: 64,333,444 (GRCm39) K18* probably null Het
Ptpra T A 2: 130,386,417 (GRCm39) D622E probably damaging Het
Ptprs A T 17: 56,725,988 (GRCm39) F1431L probably benign Het
Pxdn A G 12: 30,044,479 (GRCm39) I486V probably benign Het
Rnpc3 G A 3: 113,422,004 (GRCm39) A77V probably benign Het
Rtl10 T A 16: 18,320,026 (GRCm39) C85* probably null Het
Skint10 A G 4: 112,586,170 (GRCm39) S149P probably benign Het
Slc17a8 A C 10: 89,412,275 (GRCm39) V570G probably benign Het
Slc25a42 A T 8: 70,642,148 (GRCm39) V98E probably damaging Het
Smco2 A G 6: 146,760,363 (GRCm39) E73G probably benign Het
Ss18 T C 18: 14,812,477 (GRCm39) Y38C probably damaging Het
Sspo T A 6: 48,453,540 (GRCm39) C2909* probably null Het
Tbccd1 A G 16: 22,652,747 (GRCm39) Y125H probably benign Het
Tdrd9 A G 12: 111,980,888 (GRCm39) T446A probably damaging Het
Tecta G T 9: 42,255,183 (GRCm39) Q1672K probably benign Het
Tek G C 4: 94,692,541 (GRCm39) W216C probably damaging Het
Timm17a C T 1: 135,241,313 (GRCm39) probably null Het
Tlr4 A T 4: 66,758,188 (GRCm39) H327L probably benign Het
Trim33 T C 3: 103,234,109 (GRCm39) I449T possibly damaging Het
Vmn1r57 A G 7: 5,223,559 (GRCm39) N28S probably null Het
Vmn2r117 T A 17: 23,696,177 (GRCm39) H410L probably damaging Het
Vmn2r16 A G 5: 109,508,772 (GRCm39) E500G probably damaging Het
Wif1 A G 10: 120,926,019 (GRCm39) N245S possibly damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTAGTCTTAAAGCGTCTGGA -3'
(R):5'- GGTTGGGGTTCTAAATATCTGGCA -3'

Sequencing Primer
(F):5'- GAGAGTTCCGTGCCATTAACC -3'
(R):5'- CTAAATATCTGGCATGCAGGTGCTC -3'
Posted On 2019-06-26