Incidental Mutation 'R7220:Atm'
ID 561743
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Name ataxia telangiectasia mutated
Synonyms C030026E19Rik
MMRRC Submission 045292-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R7220 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 53350449-53448040 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 53423217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 636 (C636*)
Ref Sequence ENSEMBL: ENSMUSP00000113388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000118282
AA Change: C636*
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: C636*

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000232179
AA Change: C636*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,837,337 (GRCm39) H325Q probably damaging Het
Aasdh T C 5: 77,049,772 (GRCm39) I75V probably benign Het
Abca14 G A 7: 119,826,667 (GRCm39) D438N possibly damaging Het
Abca8a T A 11: 109,980,793 (GRCm39) I82F probably benign Het
Abca8b G T 11: 109,872,543 (GRCm39) N19K probably damaging Het
Acan A G 7: 78,757,896 (GRCm39) N506S Het
Alox12e C A 11: 70,206,731 (GRCm39) R652L probably benign Het
Atad3a A G 4: 155,838,498 (GRCm39) V173A probably benign Het
Atl3 A G 19: 7,506,433 (GRCm39) K326R probably null Het
Atp2c2 G A 8: 120,472,300 (GRCm39) M451I probably benign Het
Best1 A T 19: 9,969,479 (GRCm39) M193K probably benign Het
Bmper G T 9: 23,310,651 (GRCm39) G362C probably damaging Het
Brd4 T A 17: 32,444,557 (GRCm39) Y139F unknown Het
Bzw2 A T 12: 36,173,950 (GRCm39) I108N possibly damaging Het
Cbs C A 17: 31,838,191 (GRCm39) V353L probably benign Het
Ceacam20 A G 7: 19,701,678 (GRCm39) T22A probably damaging Het
Ckap2l C T 2: 129,117,436 (GRCm39) E580K probably damaging Het
Ckmt1 T C 2: 121,189,374 (GRCm39) L15P possibly damaging Het
Clec18a G T 8: 111,808,204 (GRCm39) P66H probably benign Het
Cma1 G T 14: 56,180,120 (GRCm39) T95K probably benign Het
Csmd3 A G 15: 48,320,994 (GRCm39) V272A probably damaging Het
Ctnna3 A T 10: 64,670,368 (GRCm39) E632D probably benign Het
Ctsc T C 7: 87,946,361 (GRCm39) L130P probably damaging Het
Frmpd2 A T 14: 33,229,432 (GRCm39) R339S probably damaging Het
Frrs1 C A 3: 116,674,425 (GRCm39) S69* probably null Het
Gcc2 A T 10: 58,116,416 (GRCm39) E1108D probably benign Het
Gkn1 A T 6: 87,326,135 (GRCm39) probably null Het
Gtf2a1 A T 12: 91,534,498 (GRCm39) M252K probably benign Het
H2-Ob T C 17: 34,460,234 (GRCm39) F115S probably damaging Het
Ighv1-53 T C 12: 115,122,135 (GRCm39) N80S probably benign Het
Ighv1-67 T C 12: 115,567,666 (GRCm39) K82R probably benign Het
Ints1 A T 5: 139,747,828 (GRCm39) I1193N possibly damaging Het
Kmt2c A G 5: 25,549,923 (GRCm39) F1353L probably damaging Het
Luc7l C T 17: 26,472,219 (GRCm39) probably benign Het
Man1a A C 10: 53,796,331 (GRCm39) S454A possibly damaging Het
Mars2 C A 1: 55,277,222 (GRCm39) A275D probably damaging Het
Nrde2 A G 12: 100,097,178 (GRCm39) V874A probably benign Het
Ociad1 A G 5: 73,470,809 (GRCm39) T244A probably benign Het
Or10j2 A G 1: 173,097,811 (GRCm39) Y23C possibly damaging Het
Or3a10 A T 11: 73,935,589 (GRCm39) D170E possibly damaging Het
Or8c9 A T 9: 38,241,046 (GRCm39) L51F probably damaging Het
Ovca2 A G 11: 75,069,501 (GRCm39) C41R possibly damaging Het
Pacsin2 A T 15: 83,269,260 (GRCm39) D11E probably damaging Het
Pcdh15 G A 10: 74,178,441 (GRCm39) S566N possibly damaging Het
Pde3b A G 7: 114,135,297 (GRCm39) I1038M probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pkhd1 T A 1: 20,593,350 (GRCm39) T1588S possibly damaging Het
Ppig A G 2: 69,580,320 (GRCm39) D618G unknown Het
Pramel17 A G 4: 101,694,565 (GRCm39) F106S probably benign Het
Prorp G A 12: 55,351,200 (GRCm39) V170M possibly damaging Het
Prss51 A T 14: 64,333,444 (GRCm39) K18* probably null Het
Ptpra T A 2: 130,386,417 (GRCm39) D622E probably damaging Het
Ptprs A T 17: 56,725,988 (GRCm39) F1431L probably benign Het
Pxdn A G 12: 30,044,479 (GRCm39) I486V probably benign Het
Rnpc3 G A 3: 113,422,004 (GRCm39) A77V probably benign Het
Rtl10 T A 16: 18,320,026 (GRCm39) C85* probably null Het
Skint10 A G 4: 112,586,170 (GRCm39) S149P probably benign Het
Slc17a8 A C 10: 89,412,275 (GRCm39) V570G probably benign Het
Slc25a42 A T 8: 70,642,148 (GRCm39) V98E probably damaging Het
Smco2 A G 6: 146,760,363 (GRCm39) E73G probably benign Het
Ss18 T C 18: 14,812,477 (GRCm39) Y38C probably damaging Het
Sspo T A 6: 48,453,540 (GRCm39) C2909* probably null Het
Tbccd1 A G 16: 22,652,747 (GRCm39) Y125H probably benign Het
Tdrd9 A G 12: 111,980,888 (GRCm39) T446A probably damaging Het
Tecta G T 9: 42,255,183 (GRCm39) Q1672K probably benign Het
Tek G C 4: 94,692,541 (GRCm39) W216C probably damaging Het
Timm17a C T 1: 135,241,313 (GRCm39) probably null Het
Tlr4 A T 4: 66,758,188 (GRCm39) H327L probably benign Het
Trim33 T C 3: 103,234,109 (GRCm39) I449T possibly damaging Het
Vmn1r57 A G 7: 5,223,559 (GRCm39) N28S probably null Het
Vmn2r117 T A 17: 23,696,177 (GRCm39) H410L probably damaging Het
Vmn2r16 A G 5: 109,508,772 (GRCm39) E500G probably damaging Het
Wif1 A G 10: 120,926,019 (GRCm39) N245S possibly damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53,435,743 (GRCm39) missense probably damaging 1.00
IGL00466:Atm APN 9 53,410,412 (GRCm39) splice site probably benign
IGL00567:Atm APN 9 53,414,416 (GRCm39) nonsense probably null
IGL00702:Atm APN 9 53,423,131 (GRCm39) missense probably benign 0.02
IGL00743:Atm APN 9 53,424,416 (GRCm39) missense probably benign 0.00
IGL00771:Atm APN 9 53,404,354 (GRCm39) missense probably benign 0.01
IGL00773:Atm APN 9 53,433,444 (GRCm39) missense probably benign 0.00
IGL00819:Atm APN 9 53,429,831 (GRCm39) missense probably damaging 1.00
IGL00864:Atm APN 9 53,445,233 (GRCm39) missense probably damaging 0.99
IGL00985:Atm APN 9 53,371,116 (GRCm39) missense probably damaging 0.98
IGL01109:Atm APN 9 53,401,593 (GRCm39) missense probably damaging 1.00
IGL01120:Atm APN 9 53,372,422 (GRCm39) critical splice acceptor site probably null
IGL01369:Atm APN 9 53,426,617 (GRCm39) missense probably benign
IGL01374:Atm APN 9 53,443,024 (GRCm39) missense possibly damaging 0.58
IGL01406:Atm APN 9 53,351,046 (GRCm39) makesense probably null
IGL01409:Atm APN 9 53,410,471 (GRCm39) missense probably benign 0.01
IGL01434:Atm APN 9 53,419,107 (GRCm39) missense probably benign 0.04
IGL01486:Atm APN 9 53,421,513 (GRCm39) missense probably benign
IGL01583:Atm APN 9 53,395,547 (GRCm39) splice site probably benign
IGL01861:Atm APN 9 53,405,912 (GRCm39) missense probably null 0.89
IGL01865:Atm APN 9 53,372,302 (GRCm39) missense probably damaging 1.00
IGL02026:Atm APN 9 53,353,717 (GRCm39) splice site probably null
IGL02072:Atm APN 9 53,371,096 (GRCm39) missense probably benign 0.01
IGL02075:Atm APN 9 53,438,537 (GRCm39) missense probably damaging 1.00
IGL02127:Atm APN 9 53,399,283 (GRCm39) missense probably damaging 1.00
IGL02175:Atm APN 9 53,391,965 (GRCm39) missense probably damaging 0.99
IGL02246:Atm APN 9 53,438,485 (GRCm39) missense probably benign 0.12
IGL02259:Atm APN 9 53,429,794 (GRCm39) splice site probably benign
IGL02351:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02358:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02387:Atm APN 9 53,391,066 (GRCm39) splice site probably null
IGL02417:Atm APN 9 53,390,995 (GRCm39) missense probably benign 0.00
IGL02422:Atm APN 9 53,412,092 (GRCm39) missense probably damaging 1.00
IGL02445:Atm APN 9 53,365,630 (GRCm39) missense probably benign 0.00
IGL02492:Atm APN 9 53,367,159 (GRCm39) missense probably damaging 0.99
IGL02513:Atm APN 9 53,408,562 (GRCm39) splice site probably benign
IGL02633:Atm APN 9 53,359,453 (GRCm39) missense probably damaging 1.00
IGL02634:Atm APN 9 53,427,863 (GRCm39) missense probably benign 0.00
IGL02948:Atm APN 9 53,364,740 (GRCm39) splice site probably benign
IGL02959:Atm APN 9 53,382,718 (GRCm39) missense probably damaging 1.00
IGL02965:Atm APN 9 53,364,863 (GRCm39) missense probably damaging 1.00
IGL03085:Atm APN 9 53,395,471 (GRCm39) missense possibly damaging 0.89
antebellum UTSW 9 53,429,859 (GRCm39) nonsense probably null
bull_run UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
Civil UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
gettysburg UTSW 9 53,367,288 (GRCm39) splice site probably null
Grant UTSW 9 53,423,217 (GRCm39) nonsense probably null
Indicative UTSW 9 53,356,676 (GRCm39) splice site probably null
Marker UTSW 9 53,365,579 (GRCm39) splice site probably benign
maunder UTSW 9 53,410,497 (GRCm39) nonsense probably null
mockingbird UTSW 9 53,427,767 (GRCm39) nonsense probably null
mockingbird2 UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
osphere UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
shiloh UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
Strato UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
thrasher UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
Tropo UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
P0019:Atm UTSW 9 53,376,328 (GRCm39) splice site probably benign
PIT4403001:Atm UTSW 9 53,412,282 (GRCm39) missense probably benign
PIT4687001:Atm UTSW 9 53,398,112 (GRCm39) critical splice donor site probably null
R0004:Atm UTSW 9 53,364,828 (GRCm39) splice site probably benign
R0035:Atm UTSW 9 53,424,480 (GRCm39) missense probably benign 0.01
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0201:Atm UTSW 9 53,365,579 (GRCm39) splice site probably benign
R0304:Atm UTSW 9 53,427,644 (GRCm39) missense probably benign 0.34
R0308:Atm UTSW 9 53,365,773 (GRCm39) splice site probably null
R0362:Atm UTSW 9 53,370,138 (GRCm39) missense possibly damaging 0.90
R0470:Atm UTSW 9 53,372,266 (GRCm39) missense probably damaging 1.00
R0513:Atm UTSW 9 53,415,248 (GRCm39) missense probably benign 0.00
R0589:Atm UTSW 9 53,401,492 (GRCm39) missense possibly damaging 0.51
R0617:Atm UTSW 9 53,370,241 (GRCm39) nonsense probably null
R0630:Atm UTSW 9 53,442,922 (GRCm39) splice site probably benign
R0652:Atm UTSW 9 53,397,314 (GRCm39) missense probably damaging 0.98
R0698:Atm UTSW 9 53,426,539 (GRCm39) missense probably damaging 1.00
R0737:Atm UTSW 9 53,367,866 (GRCm39) missense probably damaging 1.00
R0885:Atm UTSW 9 53,371,123 (GRCm39) missense probably benign
R0947:Atm UTSW 9 53,415,392 (GRCm39) missense probably benign 0.01
R0948:Atm UTSW 9 53,407,258 (GRCm39) missense probably benign
R1144:Atm UTSW 9 53,422,998 (GRCm39) splice site probably benign
R1252:Atm UTSW 9 53,367,140 (GRCm39) missense probably damaging 1.00
R1295:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1296:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1419:Atm UTSW 9 53,368,789 (GRCm39) missense probably benign 0.00
R1477:Atm UTSW 9 53,375,573 (GRCm39) missense probably benign 0.00
R1596:Atm UTSW 9 53,364,678 (GRCm39) missense probably damaging 1.00
R1630:Atm UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
R1667:Atm UTSW 9 53,412,232 (GRCm39) missense probably damaging 1.00
R1681:Atm UTSW 9 53,433,455 (GRCm39) missense possibly damaging 0.94
R1703:Atm UTSW 9 53,412,000 (GRCm39) missense probably benign
R1817:Atm UTSW 9 53,403,533 (GRCm39) splice site probably benign
R1840:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1848:Atm UTSW 9 53,379,312 (GRCm39) missense probably benign 0.06
R1906:Atm UTSW 9 53,417,868 (GRCm39) missense probably damaging 1.00
R1958:Atm UTSW 9 53,382,718 (GRCm39) missense probably damaging 1.00
R2108:Atm UTSW 9 53,355,297 (GRCm39) missense probably damaging 1.00
R2116:Atm UTSW 9 53,412,269 (GRCm39) missense probably benign 0.36
R2134:Atm UTSW 9 53,379,264 (GRCm39) critical splice donor site probably null
R2137:Atm UTSW 9 53,364,675 (GRCm39) missense probably damaging 1.00
R2291:Atm UTSW 9 53,402,209 (GRCm39) splice site probably null
R2348:Atm UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
R2483:Atm UTSW 9 53,421,566 (GRCm39) missense probably damaging 1.00
R2567:Atm UTSW 9 53,368,770 (GRCm39) missense possibly damaging 0.72
R2897:Atm UTSW 9 53,419,105 (GRCm39) missense probably damaging 0.99
R2939:Atm UTSW 9 53,406,011 (GRCm39) missense probably damaging 1.00
R3008:Atm UTSW 9 53,392,050 (GRCm39) missense probably benign 0.00
R3236:Atm UTSW 9 53,391,048 (GRCm39) missense probably benign 0.15
R3847:Atm UTSW 9 53,414,375 (GRCm39) missense possibly damaging 0.94
R3889:Atm UTSW 9 53,417,936 (GRCm39) splice site probably benign
R3919:Atm UTSW 9 53,403,578 (GRCm39) missense probably benign 0.00
R4125:Atm UTSW 9 53,361,921 (GRCm39) missense probably damaging 1.00
R4222:Atm UTSW 9 53,391,969 (GRCm39) missense probably benign
R4395:Atm UTSW 9 53,376,527 (GRCm39) missense probably benign 0.09
R4466:Atm UTSW 9 53,359,469 (GRCm39) nonsense probably null
R4502:Atm UTSW 9 53,407,246 (GRCm39) missense possibly damaging 0.92
R4514:Atm UTSW 9 53,404,339 (GRCm39) missense probably damaging 0.99
R4528:Atm UTSW 9 53,412,059 (GRCm39) missense probably benign 0.39
R4593:Atm UTSW 9 53,364,894 (GRCm39) missense possibly damaging 0.55
R4627:Atm UTSW 9 53,367,806 (GRCm39) missense possibly damaging 0.79
R4634:Atm UTSW 9 53,443,033 (GRCm39) missense probably benign 0.01
R4665:Atm UTSW 9 53,375,529 (GRCm39) missense probably benign 0.00
R4672:Atm UTSW 9 53,433,501 (GRCm39) missense probably damaging 0.99
R4741:Atm UTSW 9 53,364,907 (GRCm39) missense probably benign 0.10
R4808:Atm UTSW 9 53,356,795 (GRCm39) missense probably damaging 0.99
R4959:Atm UTSW 9 53,426,601 (GRCm39) missense probably benign
R4996:Atm UTSW 9 53,435,807 (GRCm39) missense probably benign 0.09
R5030:Atm UTSW 9 53,431,409 (GRCm39) nonsense probably null
R5214:Atm UTSW 9 53,402,327 (GRCm39) missense probably benign 0.09
R5260:Atm UTSW 9 53,417,911 (GRCm39) missense probably damaging 0.99
R5311:Atm UTSW 9 53,429,923 (GRCm39) missense probably benign 0.00
R5394:Atm UTSW 9 53,419,077 (GRCm39) critical splice donor site probably null
R5400:Atm UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
R5436:Atm UTSW 9 53,371,104 (GRCm39) missense probably benign 0.00
R5441:Atm UTSW 9 53,427,767 (GRCm39) nonsense probably null
R5569:Atm UTSW 9 53,427,750 (GRCm39) nonsense probably null
R5856:Atm UTSW 9 53,407,255 (GRCm39) missense possibly damaging 0.64
R5891:Atm UTSW 9 53,408,459 (GRCm39) missense probably benign
R5910:Atm UTSW 9 53,359,380 (GRCm39) missense probably damaging 0.96
R6054:Atm UTSW 9 53,371,173 (GRCm39) missense probably damaging 1.00
R6062:Atm UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
R6092:Atm UTSW 9 53,435,714 (GRCm39) missense probably damaging 1.00
R6127:Atm UTSW 9 53,435,809 (GRCm39) missense probably damaging 1.00
R6160:Atm UTSW 9 53,402,259 (GRCm39) missense probably benign 0.04
R6267:Atm UTSW 9 53,355,300 (GRCm39) missense probably damaging 1.00
R6273:Atm UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
R6284:Atm UTSW 9 53,356,676 (GRCm39) splice site probably null
R6478:Atm UTSW 9 53,401,554 (GRCm39) missense probably damaging 1.00
R6547:Atm UTSW 9 53,351,457 (GRCm39) missense probably damaging 1.00
R6549:Atm UTSW 9 53,404,477 (GRCm39) missense probably benign 0.00
R6704:Atm UTSW 9 53,370,153 (GRCm39) missense probably benign 0.02
R6715:Atm UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
R6737:Atm UTSW 9 53,397,351 (GRCm39) missense probably benign 0.30
R6759:Atm UTSW 9 53,429,859 (GRCm39) nonsense probably null
R6766:Atm UTSW 9 53,401,582 (GRCm39) missense probably damaging 0.99
R6813:Atm UTSW 9 53,408,535 (GRCm39) missense probably benign 0.00
R6852:Atm UTSW 9 53,393,730 (GRCm39) missense possibly damaging 0.93
R7064:Atm UTSW 9 53,419,181 (GRCm39) missense probably benign 0.02
R7208:Atm UTSW 9 53,423,308 (GRCm39) splice site probably null
R7211:Atm UTSW 9 53,399,860 (GRCm39) missense probably benign 0.01
R7336:Atm UTSW 9 53,373,803 (GRCm39) missense possibly damaging 0.47
R7363:Atm UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
R7378:Atm UTSW 9 53,364,737 (GRCm39) critical splice acceptor site probably null
R7472:Atm UTSW 9 53,359,425 (GRCm39) missense possibly damaging 0.81
R7487:Atm UTSW 9 53,435,654 (GRCm39) missense probably benign
R7497:Atm UTSW 9 53,423,191 (GRCm39) missense probably benign 0.00
R7584:Atm UTSW 9 53,424,427 (GRCm39) missense probably damaging 0.99
R7624:Atm UTSW 9 53,366,068 (GRCm39) missense probably damaging 0.99
R7653:Atm UTSW 9 53,401,602 (GRCm39) nonsense probably null
R7660:Atm UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
R7679:Atm UTSW 9 53,353,797 (GRCm39) missense probably damaging 1.00
R7720:Atm UTSW 9 53,433,539 (GRCm39) missense possibly damaging 0.54
R8221:Atm UTSW 9 53,367,288 (GRCm39) splice site probably null
R8247:Atm UTSW 9 53,361,870 (GRCm39) missense
R8334:Atm UTSW 9 53,433,573 (GRCm39) missense probably benign 0.00
R8503:Atm UTSW 9 53,399,352 (GRCm39) missense probably damaging 0.99
R8552:Atm UTSW 9 53,435,797 (GRCm39) missense probably damaging 1.00
R8749:Atm UTSW 9 53,410,497 (GRCm39) nonsense probably null
R8838:Atm UTSW 9 53,427,851 (GRCm39) missense probably damaging 0.99
R9126:Atm UTSW 9 53,370,134 (GRCm39) missense probably benign 0.01
R9131:Atm UTSW 9 53,445,044 (GRCm39) missense probably benign 0.10
R9191:Atm UTSW 9 53,438,590 (GRCm39) missense probably benign 0.29
R9257:Atm UTSW 9 53,407,150 (GRCm39) critical splice donor site probably null
R9473:Atm UTSW 9 53,410,272 (GRCm39) missense probably benign
R9558:Atm UTSW 9 53,412,081 (GRCm39) missense probably benign 0.00
R9598:Atm UTSW 9 53,431,381 (GRCm39) missense probably benign 0.34
R9717:Atm UTSW 9 53,427,817 (GRCm39) missense probably damaging 1.00
R9794:Atm UTSW 9 53,429,867 (GRCm39) missense probably benign
X0067:Atm UTSW 9 53,390,994 (GRCm39) missense probably benign 0.00
Z1088:Atm UTSW 9 53,442,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAAGAATACACCTGAATTCG -3'
(R):5'- GCCCAAAGAAGAGAAGCATTTC -3'

Sequencing Primer
(F):5'- CTGATAATCCCAGAAGATAGTGATCC -3'
(R):5'- AGAGAAGCATTTCACAGAATAACTC -3'
Posted On 2019-06-26