Mutagenetix > Incidental Mutations

Incidental Mutation 'R7220:Atm'

561743

Institutional Source

Beutler Lab

Gene Symbol

Atm

Ensembl Gene

ENSMUSG00000034218

Gene Name

ataxia telangiectasia mutated

Synonyms

C030026E19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.844) question?

Stock #

R7220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53439149-53536740 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 53511917 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 636 (C636*)

Ref Sequence

ENSEMBL: ENSMUSP00000113388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]

Predicted Effect

probably null
Transcript: ENSMUST00000118282
AA Change: C636*

SMART Domains

Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: C636*

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000232179
AA Change: C636*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	A	12: 55,304,415	V170M	possibly damaging	Het
5031439G07Rik	A	T	15: 84,953,136	H325Q	probably damaging	Het
Aasdh	T	C	5: 76,901,925	I75V	probably benign	Het
Abca14	G	A	7: 120,227,444	D438N	possibly damaging	Het
Abca8a	T	A	11: 110,089,967	I82F	probably benign	Het
Abca8b	G	T	11: 109,981,717	N19K	probably damaging	Het
Acan	A	G	7: 79,108,148	N506S		Het
Alox12e	C	A	11: 70,315,905	R652L	probably benign	Het
Atad3a	A	G	4: 155,754,041	V173A	probably benign	Het
Atl3	A	G	19: 7,529,068	K326R	probably null	Het
Atp2c2	G	A	8: 119,745,561	M451I	probably benign	Het
B020004J07Rik	A	G	4: 101,837,368	F106S	probably benign	Het
Best1	A	T	19: 9,992,115	M193K	probably benign	Het
Bmper	G	T	9: 23,399,355	G362C	probably damaging	Het
Brd4	T	A	17: 32,225,583	Y139F	unknown	Het
Bzw2	A	T	12: 36,123,951	I108N	possibly damaging	Het
Cbs	C	A	17: 31,619,217	V353L	probably benign	Het
Ceacam20	A	G	7: 19,967,753	T22A	probably damaging	Het
Ckap2l	C	T	2: 129,275,516	E580K	probably damaging	Het
Ckmt1	T	C	2: 121,358,893	L15P	possibly damaging	Het
Clec18a	G	T	8: 111,081,572	P66H	probably benign	Het
Cma1	G	T	14: 55,942,663	T95K	probably benign	Het
Csmd3	A	G	15: 48,457,598	V272A	probably damaging	Het
Ctnna3	A	T	10: 64,834,589	E632D	probably benign	Het
Ctsc	T	C	7: 88,297,153	L130P	probably damaging	Het
Frmpd2	A	T	14: 33,507,475	R339S	probably damaging	Het
Frrs1	C	A	3: 116,880,776	S69*	probably null	Het
Gcc2	A	T	10: 58,280,594	E1108D	probably benign	Het
Gkn1	A	T	6: 87,349,153		probably null	Het
Gtf2a1	A	T	12: 91,567,724	M252K	probably benign	Het
H2-Ob	T	C	17: 34,241,260	F115S	probably damaging	Het
Ighv1-53	T	C	12: 115,158,515	N80S	probably benign	Het
Ighv1-67	T	C	12: 115,604,046	K82R	probably benign	Het
Ints1	A	T	5: 139,762,073	I1193N	possibly damaging	Het
Kmt2c	A	G	5: 25,344,925	F1353L	probably damaging	Het
Luc7l	C	T	17: 26,253,245		probably benign	Het
Man1a	A	C	10: 53,920,235	S454A	possibly damaging	Het
Mars2	C	A	1: 55,238,063	A275D	probably damaging	Het
Nrde2	A	G	12: 100,130,919	V874A	probably benign	Het
Ociad1	A	G	5: 73,313,466	T244A	probably benign	Het
Olfr139	A	T	11: 74,044,763	D170E	possibly damaging	Het
Olfr25	A	T	9: 38,329,750	L51F	probably damaging	Het
Olfr418	A	G	1: 173,270,244	Y23C	possibly damaging	Het
Ovca2	A	G	11: 75,178,675	C41R	possibly damaging	Het
Pacsin2	A	T	15: 83,385,059	D11E	probably damaging	Het
Pcdh15	G	A	10: 74,342,609	S566N	possibly damaging	Het
Pde3b	A	G	7: 114,536,062	I1038M	probably damaging	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Pkhd1	T	A	1: 20,523,126	T1588S	possibly damaging	Het
Ppig	A	G	2: 69,749,976	D618G	unknown	Het
Prss51	A	T	14: 64,095,995	K18*	probably null	Het
Ptpra	T	A	2: 130,544,497	D622E	probably damaging	Het
Ptprs	A	T	17: 56,418,988	F1431L	probably benign	Het
Pxdn	A	G	12: 29,994,480	I486V	probably benign	Het
Rnpc3	G	A	3: 113,628,355	A77V	probably benign	Het
Rtl10	T	A	16: 18,501,276	C85*	probably null	Het
Skint10	A	G	4: 112,728,973	S149P	probably benign	Het
Slc17a8	A	C	10: 89,576,413	V570G	probably benign	Het
Slc25a42	A	T	8: 70,189,498	V98E	probably damaging	Het
Smco2	A	G	6: 146,858,865	E73G	probably benign	Het
Ss18	T	C	18: 14,679,420	Y38C	probably damaging	Het
Sspo	T	A	6: 48,476,606	C2909*	probably null	Het
Tbccd1	A	G	16: 22,833,997	Y125H	probably benign	Het
Tdrd9	A	G	12: 112,014,454	T446A	probably damaging	Het
Tecta	G	T	9: 42,343,887	Q1672K	probably benign	Het
Tek	G	C	4: 94,804,304	W216C	probably damaging	Het
Timm17a	C	T	1: 135,313,575		probably null	Het
Tlr4	A	T	4: 66,839,951	H327L	probably benign	Het
Trim33	T	C	3: 103,326,793	I449T	possibly damaging	Het
Vmn1r57	A	G	7: 5,220,560	N28S	probably null	Het
Vmn2r117	T	A	17: 23,477,203	H410L	probably damaging	Het
Vmn2r16	A	G	5: 109,360,906	E500G	probably damaging	Het
Wif1	A	G	10: 121,090,114	N245S	possibly damaging	Het

Other mutations in Atm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Atm	APN	9	53524443	missense	probably damaging	1.00
IGL00466:Atm	APN	9	53499112	splice site	probably benign
IGL00567:Atm	APN	9	53503116	nonsense	probably null
IGL00702:Atm	APN	9	53511831	missense	probably benign	0.02
IGL00743:Atm	APN	9	53513116	missense	probably benign	0.00
IGL00771:Atm	APN	9	53493054	missense	probably benign	0.01
IGL00773:Atm	APN	9	53522144	missense	probably benign	0.00
IGL00819:Atm	APN	9	53518531	missense	probably damaging	1.00
IGL00864:Atm	APN	9	53533933	missense	probably damaging	0.99
IGL00985:Atm	APN	9	53459816	missense	probably damaging	0.98
IGL01109:Atm	APN	9	53490293	missense	probably damaging	1.00
IGL01120:Atm	APN	9	53461122	critical splice acceptor site	probably null
IGL01369:Atm	APN	9	53515317	missense	probably benign
IGL01374:Atm	APN	9	53531724	missense	possibly damaging	0.58
IGL01406:Atm	APN	9	53439746	makesense	probably null
IGL01409:Atm	APN	9	53499171	missense	probably benign	0.01
IGL01434:Atm	APN	9	53507807	missense	probably benign	0.04
IGL01486:Atm	APN	9	53510213	missense	probably benign
IGL01583:Atm	APN	9	53484247	splice site	probably benign
IGL01861:Atm	APN	9	53494612	missense	probably null	0.89
IGL01865:Atm	APN	9	53461002	missense	probably damaging	1.00
IGL02026:Atm	APN	9	53442417	splice site	probably null
IGL02072:Atm	APN	9	53459796	missense	probably benign	0.01
IGL02075:Atm	APN	9	53527237	missense	probably damaging	1.00
IGL02127:Atm	APN	9	53487983	missense	probably damaging	1.00
IGL02175:Atm	APN	9	53480665	missense	probably damaging	0.99
IGL02246:Atm	APN	9	53527185	missense	probably benign	0.12
IGL02259:Atm	APN	9	53518494	splice site	probably benign
IGL02351:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02358:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02387:Atm	APN	9	53479766	splice site	probably null
IGL02417:Atm	APN	9	53479695	missense	probably benign	0.00
IGL02422:Atm	APN	9	53500792	missense	probably damaging	1.00
IGL02445:Atm	APN	9	53454330	missense	probably benign	0.00
IGL02492:Atm	APN	9	53455859	missense	probably damaging	0.99
IGL02513:Atm	APN	9	53497262	splice site	probably benign
IGL02633:Atm	APN	9	53448153	missense	probably damaging	1.00
IGL02634:Atm	APN	9	53516563	missense	probably benign	0.00
IGL02948:Atm	APN	9	53453440	splice site	probably benign
IGL02959:Atm	APN	9	53471418	missense	probably damaging	1.00
IGL02965:Atm	APN	9	53453563	missense	probably damaging	1.00
IGL03085:Atm	APN	9	53484171	missense	possibly damaging	0.89
antebellum	UTSW	9	53518559	nonsense	probably null
bull_run	UTSW	9	53487922	missense	probably benign	0.09
Civil	UTSW	9	53492268	missense	possibly damaging	0.78
gettysburg	UTSW	9	53455988	splice site	probably null
Grant	UTSW	9	53511917	nonsense	probably null
mockingbird	UTSW	9	53516467	nonsense	probably null
mockingbird2	UTSW	9	53488587	missense	probably damaging	1.00
osphere	UTSW	9	53479673	missense	probably damaging	0.99
shiloh	UTSW	9	53465298	missense	probably damaging	1.00
Strato	UTSW	9	53503018	missense	probably damaging	1.00
thrasher	UTSW	9	53445507	missense	probably benign	0.01
Tropo	UTSW	9	53531648	missense	probably damaging	1.00
P0019:Atm	UTSW	9	53465028	splice site	probably benign
PIT4403001:Atm	UTSW	9	53500982	missense	probably benign
PIT4687001:Atm	UTSW	9	53486812	critical splice donor site	probably null
R0004:Atm	UTSW	9	53453528	splice site	probably benign
R0035:Atm	UTSW	9	53513180	missense	probably benign	0.01
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0201:Atm	UTSW	9	53454279	splice site	probably benign
R0304:Atm	UTSW	9	53516344	missense	probably benign	0.34
R0308:Atm	UTSW	9	53454473	splice site	probably null
R0362:Atm	UTSW	9	53458838	missense	possibly damaging	0.90
R0470:Atm	UTSW	9	53460966	missense	probably damaging	1.00
R0513:Atm	UTSW	9	53503948	missense	probably benign	0.00
R0589:Atm	UTSW	9	53490192	missense	possibly damaging	0.51
R0617:Atm	UTSW	9	53458941	nonsense	probably null
R0630:Atm	UTSW	9	53531622	splice site	probably benign
R0652:Atm	UTSW	9	53486014	missense	probably damaging	0.98
R0698:Atm	UTSW	9	53515239	missense	probably damaging	1.00
R0737:Atm	UTSW	9	53456566	missense	probably damaging	1.00
R0885:Atm	UTSW	9	53459823	missense	probably benign
R0947:Atm	UTSW	9	53504092	missense	probably benign	0.01
R0948:Atm	UTSW	9	53495958	missense	probably benign
R1144:Atm	UTSW	9	53511698	splice site	probably benign
R1252:Atm	UTSW	9	53455840	missense	probably damaging	1.00
R1295:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1296:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1419:Atm	UTSW	9	53457489	missense	probably benign	0.00
R1477:Atm	UTSW	9	53464273	missense	probably benign	0.00
R1596:Atm	UTSW	9	53453378	missense	probably damaging	1.00
R1630:Atm	UTSW	9	53479673	missense	probably damaging	0.99
R1667:Atm	UTSW	9	53500932	missense	probably damaging	1.00
R1681:Atm	UTSW	9	53522155	missense	possibly damaging	0.94
R1703:Atm	UTSW	9	53500700	missense	probably benign
R1817:Atm	UTSW	9	53492233	splice site	probably benign
R1840:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1848:Atm	UTSW	9	53468012	missense	probably benign	0.06
R1906:Atm	UTSW	9	53506568	missense	probably damaging	1.00
R1958:Atm	UTSW	9	53471418	missense	probably damaging	1.00
R2108:Atm	UTSW	9	53443997	missense	probably damaging	1.00
R2116:Atm	UTSW	9	53500969	missense	probably benign	0.36
R2134:Atm	UTSW	9	53467964	critical splice donor site	probably null
R2137:Atm	UTSW	9	53453375	missense	probably damaging	1.00
R2291:Atm	UTSW	9	53490909	splice site	probably null
R2348:Atm	UTSW	9	53492268	missense	possibly damaging	0.78
R2483:Atm	UTSW	9	53510266	missense	probably damaging	1.00
R2567:Atm	UTSW	9	53457470	missense	possibly damaging	0.72
R2897:Atm	UTSW	9	53507805	missense	probably damaging	0.99
R2939:Atm	UTSW	9	53494711	missense	probably damaging	1.00
R3008:Atm	UTSW	9	53480750	missense	probably benign	0.00
R3236:Atm	UTSW	9	53479748	missense	probably benign	0.15
R3847:Atm	UTSW	9	53503075	missense	possibly damaging	0.94
R3889:Atm	UTSW	9	53506636	splice site	probably benign
R3919:Atm	UTSW	9	53492278	missense	probably benign	0.00
R4125:Atm	UTSW	9	53450621	missense	probably damaging	1.00
R4222:Atm	UTSW	9	53480669	missense	probably benign
R4395:Atm	UTSW	9	53465227	missense	probably benign	0.09
R4466:Atm	UTSW	9	53448169	nonsense	probably null
R4502:Atm	UTSW	9	53495946	missense	possibly damaging	0.92
R4514:Atm	UTSW	9	53493039	missense	probably damaging	0.99
R4528:Atm	UTSW	9	53500759	missense	probably benign	0.39
R4593:Atm	UTSW	9	53453594	missense	possibly damaging	0.55
R4627:Atm	UTSW	9	53456506	missense	possibly damaging	0.79
R4634:Atm	UTSW	9	53531733	missense	probably benign	0.01
R4665:Atm	UTSW	9	53464229	missense	probably benign	0.00
R4672:Atm	UTSW	9	53522201	missense	probably damaging	0.99
R4741:Atm	UTSW	9	53453607	missense	probably benign	0.10
R4808:Atm	UTSW	9	53445495	missense	probably damaging	0.99
R4959:Atm	UTSW	9	53515301	missense	probably benign
R4996:Atm	UTSW	9	53524507	missense	probably benign	0.09
R5030:Atm	UTSW	9	53520109	nonsense	probably null
R5214:Atm	UTSW	9	53491027	missense	probably benign	0.09
R5260:Atm	UTSW	9	53506611	missense	probably damaging	0.99
R5311:Atm	UTSW	9	53518623	missense	probably benign	0.00
R5394:Atm	UTSW	9	53507777	critical splice donor site	probably null
R5400:Atm	UTSW	9	53503018	missense	probably damaging	1.00
R5436:Atm	UTSW	9	53459804	missense	probably benign	0.00
R5441:Atm	UTSW	9	53516467	nonsense	probably null
R5569:Atm	UTSW	9	53516450	nonsense	probably null
R5856:Atm	UTSW	9	53495955	missense	possibly damaging	0.64
R5891:Atm	UTSW	9	53497159	missense	probably benign
R5910:Atm	UTSW	9	53448080	missense	probably damaging	0.96
R6054:Atm	UTSW	9	53459873	missense	probably damaging	1.00
R6062:Atm	UTSW	9	53488587	missense	probably damaging	1.00
R6092:Atm	UTSW	9	53524414	missense	probably damaging	1.00
R6127:Atm	UTSW	9	53524509	missense	probably damaging	1.00
R6160:Atm	UTSW	9	53490959	missense	probably benign	0.04
R6267:Atm	UTSW	9	53444000	missense	probably damaging	1.00
R6273:Atm	UTSW	9	53487922	missense	probably benign	0.09
R6284:Atm	UTSW	9	53445376	splice site	probably null
R6478:Atm	UTSW	9	53490254	missense	probably damaging	1.00
R6547:Atm	UTSW	9	53440157	missense	probably damaging	1.00
R6549:Atm	UTSW	9	53493177	missense	probably benign	0.00
R6704:Atm	UTSW	9	53458853	missense	probably benign	0.02
R6715:Atm	UTSW	9	53531648	missense	probably damaging	1.00
R6737:Atm	UTSW	9	53486051	missense	probably benign	0.30
R6759:Atm	UTSW	9	53518559	nonsense	probably null
R6766:Atm	UTSW	9	53490282	missense	probably damaging	0.99
R6813:Atm	UTSW	9	53497235	missense	probably benign	0.00
R6852:Atm	UTSW	9	53482430	missense	possibly damaging	0.93
R7064:Atm	UTSW	9	53507881	missense	probably benign	0.02
R7208:Atm	UTSW	9	53512008	splice site	probably null
R7211:Atm	UTSW	9	53488560	missense	probably benign	0.01
R7336:Atm	UTSW	9	53462503	missense	possibly damaging	0.47
R7363:Atm	UTSW	9	53465298	missense	probably damaging	1.00
R7378:Atm	UTSW	9	53453437	critical splice acceptor site	probably null
R7472:Atm	UTSW	9	53448125	missense	possibly damaging	0.81
R7487:Atm	UTSW	9	53524354	missense	probably benign
R7497:Atm	UTSW	9	53511891	missense	probably benign	0.00
R7584:Atm	UTSW	9	53513127	missense	probably damaging	0.99
R7624:Atm	UTSW	9	53454768	missense	probably damaging	0.99
R7653:Atm	UTSW	9	53490302	nonsense	probably null
R7660:Atm	UTSW	9	53445507	missense	probably benign	0.01
R7679:Atm	UTSW	9	53442497	missense	probably damaging	1.00
R7720:Atm	UTSW	9	53522239	missense	possibly damaging	0.54
R8221:Atm	UTSW	9	53455988	splice site	probably null
R8247:Atm	UTSW	9	53450570	missense
R8334:Atm	UTSW	9	53522273	missense	probably benign	0.00
R8503:Atm	UTSW	9	53488052	missense	probably damaging	0.99
R8552:Atm	UTSW	9	53524497	missense	probably damaging	1.00
R8749:Atm	UTSW	9	53499197	nonsense	probably null
R8838:Atm	UTSW	9	53516551	missense	probably damaging	0.99
X0067:Atm	UTSW	9	53479694	missense	probably benign	0.00
Z1088:Atm	UTSW	9	53531687	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCAAGAATACACCTGAATTCG -3'
(R):5'- GCCCAAAGAAGAGAAGCATTTC -3'

Sequencing Primer
(F):5'- CTGATAATCCCAGAAGATAGTGATCC -3'
(R):5'- AGAGAAGCATTTCACAGAATAACTC -3'

Posted On

2019-06-26