Incidental Mutation 'R7220:Olfr139'
ID561751
Institutional Source Beutler Lab
Gene Symbol Olfr139
Ensembl Gene ENSMUSG00000047444
Gene Nameolfactory receptor 139
SynonymsM5, GA_x6K02T2P1NL-4202012-4201065, MOR255-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7220 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74044033-74056551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74044763 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 170 (D170E)
Ref Sequence ENSEMBL: ENSMUSP00000146141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050678] [ENSMUST00000206280] [ENSMUST00000214111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050678
AA Change: D170E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049558
Gene: ENSMUSG00000047444
AA Change: D170E

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.4e-56 PFAM
Pfam:7TM_GPCR_Srsx 38 276 5.3e-6 PFAM
Pfam:7tm_1 44 293 8.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206280
AA Change: D170E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214111
AA Change: D170E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gkn1 A T 6: 87,349,153 probably null Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Olfr139
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0276:Olfr139 UTSW 11 74045118 missense probably damaging 1.00
R0545:Olfr139 UTSW 11 74045047 missense possibly damaging 0.90
R1560:Olfr139 UTSW 11 74044615 missense probably damaging 1.00
R1570:Olfr139 UTSW 11 74044807 missense possibly damaging 0.65
R1781:Olfr139 UTSW 11 74044960 missense probably damaging 1.00
R2002:Olfr139 UTSW 11 74045039 missense possibly damaging 0.49
R2857:Olfr139 UTSW 11 74044827 missense possibly damaging 0.93
R2858:Olfr139 UTSW 11 74044827 missense possibly damaging 0.93
R2859:Olfr139 UTSW 11 74044827 missense possibly damaging 0.93
R3874:Olfr139 UTSW 11 74044699 missense probably damaging 1.00
R5023:Olfr139 UTSW 11 74045055 missense probably damaging 1.00
R5057:Olfr139 UTSW 11 74045055 missense probably damaging 1.00
R5242:Olfr139 UTSW 11 74045022 missense possibly damaging 0.89
R5495:Olfr139 UTSW 11 74044785 missense probably damaging 1.00
R5655:Olfr139 UTSW 11 74044334 nonsense probably null
R7343:Olfr139 UTSW 11 74044900 missense possibly damaging 0.68
R7793:Olfr139 UTSW 11 74044788 missense possibly damaging 0.89
R8169:Olfr139 UTSW 11 74044881 missense possibly damaging 0.95
R8262:Olfr139 UTSW 11 74045100 missense probably damaging 1.00
R8340:Olfr139 UTSW 11 74045025 missense probably damaging 0.96
R8948:Olfr139 UTSW 11 74044956 missense possibly damaging 0.50
R8950:Olfr139 UTSW 11 74044956 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CATGTGGAAAATGCCTTCTTCC -3'
(R):5'- CAGGTGTGGACTGTCATCTC -3'

Sequencing Primer
(F):5'- ATCCGTAGTACTGCAGCTGC -3'
(R):5'- CTTGACAGCCATGGCCTATGAC -3'
Posted On2019-06-26