Incidental Mutation 'R7220:Abca8a'
ID561754
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7220 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110089967 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 82 (I82F)
Ref Sequence ENSEMBL: ENSMUSP00000097860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106662] [ENSMUST00000106664]
Predicted Effect probably benign
Transcript: ENSMUST00000046223
AA Change: I82F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: I82F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100287
AA Change: I82F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: I82F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106662
SMART Domains Protein: ENSMUSP00000102273
Gene: ENSMUSG00000041828

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106664
AA Change: I82F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: I82F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gkn1 A T 6: 87,349,153 probably null Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 intron probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7161:Abca8a UTSW 11 110074142 missense probably benign 0.09
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
R7437:Abca8a UTSW 11 110050964 missense probably benign
R7733:Abca8a UTSW 11 110054587 missense probably benign 0.02
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCATGCTGCTGATATGCTATAC -3'
(R):5'- GAAACTACAGTTGTCTTTGTTTCTTT -3'

Sequencing Primer
(F):5'- GGTCTTCCAGTTCAGTGAAAGAC -3'
(R):5'- CTTTTATCTGGCTTTGTAGGAATTCC -3'
Posted On2019-06-26