Mutagenetix > Incidental Mutations

Incidental Mutation 'R7220:Cma1'

561764

Institutional Source

Beutler Lab

Gene Symbol

Cma1

Ensembl Gene

ENSMUSG00000022225

Gene Name

chymase 1, mast cell

Synonyms

Mcp-5, MMCP-5, Mcpt5, Mcp5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R7220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55941451-55944675 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 55942663 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 95 (T95K)

Ref Sequence

ENSEMBL: ENSMUSP00000022834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022834] [ENSMUST00000226280]

AlphaFold

P21844

Predicted Effect

probably benign
Transcript: ENSMUST00000022834
AA Change: T95K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022834
Gene: ENSMUSG00000022225
AA Change: T95K

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Tryp_SPc	34	253	4.85e-73	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226280
AA Change: T82K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: This gene encodes a serine protease that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. The encoded preproprotein undergoes proteolytic processing to generate a functional enzyme with elastase-like activity. Mice lacking the encoded protein exhibit significant attenuation of ischemia-reperfusion injury of the skeletal muscle. This gene is located in a cluster of related mast cell protease genes on chromosome 14. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduction in mast cell-mediated ischemia reperfusion injury of skeletal muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	A	12: 55,304,415	V170M	possibly damaging	Het
5031439G07Rik	A	T	15: 84,953,136	H325Q	probably damaging	Het
Aasdh	T	C	5: 76,901,925	I75V	probably benign	Het
Abca14	G	A	7: 120,227,444	D438N	possibly damaging	Het
Abca8a	T	A	11: 110,089,967	I82F	probably benign	Het
Abca8b	G	T	11: 109,981,717	N19K	probably damaging	Het
Acan	A	G	7: 79,108,148	N506S		Het
Alox12e	C	A	11: 70,315,905	R652L	probably benign	Het
Atad3a	A	G	4: 155,754,041	V173A	probably benign	Het
Atl3	A	G	19: 7,529,068	K326R	probably null	Het
Atm	G	T	9: 53,511,917	C636*	probably null	Het
Atp2c2	G	A	8: 119,745,561	M451I	probably benign	Het
B020004J07Rik	A	G	4: 101,837,368	F106S	probably benign	Het
Best1	A	T	19: 9,992,115	M193K	probably benign	Het
Bmper	G	T	9: 23,399,355	G362C	probably damaging	Het
Brd4	T	A	17: 32,225,583	Y139F	unknown	Het
Bzw2	A	T	12: 36,123,951	I108N	possibly damaging	Het
Cbs	C	A	17: 31,619,217	V353L	probably benign	Het
Ceacam20	A	G	7: 19,967,753	T22A	probably damaging	Het
Ckap2l	C	T	2: 129,275,516	E580K	probably damaging	Het
Ckmt1	T	C	2: 121,358,893	L15P	possibly damaging	Het
Clec18a	G	T	8: 111,081,572	P66H	probably benign	Het
Csmd3	A	G	15: 48,457,598	V272A	probably damaging	Het
Ctnna3	A	T	10: 64,834,589	E632D	probably benign	Het
Ctsc	T	C	7: 88,297,153	L130P	probably damaging	Het
Frmpd2	A	T	14: 33,507,475	R339S	probably damaging	Het
Frrs1	C	A	3: 116,880,776	S69*	probably null	Het
Gcc2	A	T	10: 58,280,594	E1108D	probably benign	Het
Gkn1	A	T	6: 87,349,153		probably null	Het
Gtf2a1	A	T	12: 91,567,724	M252K	probably benign	Het
H2-Ob	T	C	17: 34,241,260	F115S	probably damaging	Het
Ighv1-53	T	C	12: 115,158,515	N80S	probably benign	Het
Ighv1-67	T	C	12: 115,604,046	K82R	probably benign	Het
Ints1	A	T	5: 139,762,073	I1193N	possibly damaging	Het
Kmt2c	A	G	5: 25,344,925	F1353L	probably damaging	Het
Luc7l	C	T	17: 26,253,245		probably benign	Het
Man1a	A	C	10: 53,920,235	S454A	possibly damaging	Het
Mars2	C	A	1: 55,238,063	A275D	probably damaging	Het
Nrde2	A	G	12: 100,130,919	V874A	probably benign	Het
Ociad1	A	G	5: 73,313,466	T244A	probably benign	Het
Olfr139	A	T	11: 74,044,763	D170E	possibly damaging	Het
Olfr25	A	T	9: 38,329,750	L51F	probably damaging	Het
Olfr418	A	G	1: 173,270,244	Y23C	possibly damaging	Het
Ovca2	A	G	11: 75,178,675	C41R	possibly damaging	Het
Pacsin2	A	T	15: 83,385,059	D11E	probably damaging	Het
Pcdh15	G	A	10: 74,342,609	S566N	possibly damaging	Het
Pde3b	A	G	7: 114,536,062	I1038M	probably damaging	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Pkhd1	T	A	1: 20,523,126	T1588S	possibly damaging	Het
Ppig	A	G	2: 69,749,976	D618G	unknown	Het
Prss51	A	T	14: 64,095,995	K18*	probably null	Het
Ptpra	T	A	2: 130,544,497	D622E	probably damaging	Het
Ptprs	A	T	17: 56,418,988	F1431L	probably benign	Het
Pxdn	A	G	12: 29,994,480	I486V	probably benign	Het
Rnpc3	G	A	3: 113,628,355	A77V	probably benign	Het
Rtl10	T	A	16: 18,501,276	C85*	probably null	Het
Skint10	A	G	4: 112,728,973	S149P	probably benign	Het
Slc17a8	A	C	10: 89,576,413	V570G	probably benign	Het
Slc25a42	A	T	8: 70,189,498	V98E	probably damaging	Het
Smco2	A	G	6: 146,858,865	E73G	probably benign	Het
Ss18	T	C	18: 14,679,420	Y38C	probably damaging	Het
Sspo	T	A	6: 48,476,606	C2909*	probably null	Het
Tbccd1	A	G	16: 22,833,997	Y125H	probably benign	Het
Tdrd9	A	G	12: 112,014,454	T446A	probably damaging	Het
Tecta	G	T	9: 42,343,887	Q1672K	probably benign	Het
Tek	G	C	4: 94,804,304	W216C	probably damaging	Het
Timm17a	C	T	1: 135,313,575		probably null	Het
Tlr4	A	T	4: 66,839,951	H327L	probably benign	Het
Trim33	T	C	3: 103,326,793	I449T	possibly damaging	Het
Vmn1r57	A	G	7: 5,220,560	N28S	probably null	Het
Vmn2r117	T	A	17: 23,477,203	H410L	probably damaging	Het
Vmn2r16	A	G	5: 109,360,906	E500G	probably damaging	Het
Wif1	A	G	10: 121,090,114	N245S	possibly damaging	Het

Other mutations in Cma1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Cma1	APN	14	55942697	missense	probably benign	0.26
IGL02797:Cma1	APN	14	55943814	missense	possibly damaging	0.58
R0026:Cma1	UTSW	14	55942164	missense	probably damaging	1.00
R2029:Cma1	UTSW	14	55943734	missense	possibly damaging	0.81
R2060:Cma1	UTSW	14	55943698	critical splice donor site	probably null
R4994:Cma1	UTSW	14	55941671	missense	probably damaging	1.00
R5275:Cma1	UTSW	14	55941700	missense	probably damaging	1.00
R5794:Cma1	UTSW	14	55944520	missense	probably benign
R5824:Cma1	UTSW	14	55941725	missense	possibly damaging	0.79
R5955:Cma1	UTSW	14	55943769	missense	probably benign	0.20
R5958:Cma1	UTSW	14	55941656	makesense	probably null
R6075:Cma1	UTSW	14	55942314	missense	probably damaging	0.97
R6139:Cma1	UTSW	14	55942700	critical splice acceptor site	probably null
R7088:Cma1	UTSW	14	55943816	missense	probably damaging	1.00
R7139:Cma1	UTSW	14	55943816	missense	probably damaging	1.00
R7988:Cma1	UTSW	14	55944532	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- TCCAGGCAACGTACCAAGTC -3'
(R):5'- TGAGCCTGTCACTGTCTCTG -3'

Sequencing Primer
(F):5'- CGTACCAAGTCTAACAGGGG -3'
(R):5'- GCTAAGGATGATGACCTTGACTTC -3'

Posted On

2019-06-26