Incidental Mutation 'R7220:Prss51'
ID 561765
Institutional Source Beutler Lab
Gene Symbol Prss51
Ensembl Gene ENSMUSG00000052099
Gene Name serine protease 51
Synonyms 1700007N14Rik
MMRRC Submission 045292-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.394) question?
Stock # R7220 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 64323683-64335127 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 64333444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 18 (K18*)
Ref Sequence ENSEMBL: ENSMUSP00000066111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063785] [ENSMUST00000165710] [ENSMUST00000170709] [ENSMUST00000224112]
AlphaFold A0A286YDY8
Predicted Effect probably null
Transcript: ENSMUST00000063785
AA Change: K18*
SMART Domains Protein: ENSMUSP00000066111
Gene: ENSMUSG00000052099
AA Change: K18*

DomainStartEndE-ValueType
Tryp_SPc 5 171 3.93e-9 SMART
low complexity region 181 195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165710
AA Change: K36*
SMART Domains Protein: ENSMUSP00000132814
Gene: ENSMUSG00000052099
AA Change: K36*

DomainStartEndE-ValueType
Tryp_SPc 9 189 2.09e-13 SMART
low complexity region 199 213 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170709
AA Change: K18*
SMART Domains Protein: ENSMUSP00000126778
Gene: ENSMUSG00000052099
AA Change: K18*

DomainStartEndE-ValueType
Pfam:Trypsin 2 94 2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000224112
AA Change: K115*
Meta Mutation Damage Score 0.9564 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,837,337 (GRCm39) H325Q probably damaging Het
Aasdh T C 5: 77,049,772 (GRCm39) I75V probably benign Het
Abca14 G A 7: 119,826,667 (GRCm39) D438N possibly damaging Het
Abca8a T A 11: 109,980,793 (GRCm39) I82F probably benign Het
Abca8b G T 11: 109,872,543 (GRCm39) N19K probably damaging Het
Acan A G 7: 78,757,896 (GRCm39) N506S Het
Alox12e C A 11: 70,206,731 (GRCm39) R652L probably benign Het
Atad3a A G 4: 155,838,498 (GRCm39) V173A probably benign Het
Atl3 A G 19: 7,506,433 (GRCm39) K326R probably null Het
Atm G T 9: 53,423,217 (GRCm39) C636* probably null Het
Atp2c2 G A 8: 120,472,300 (GRCm39) M451I probably benign Het
Best1 A T 19: 9,969,479 (GRCm39) M193K probably benign Het
Bmper G T 9: 23,310,651 (GRCm39) G362C probably damaging Het
Brd4 T A 17: 32,444,557 (GRCm39) Y139F unknown Het
Bzw2 A T 12: 36,173,950 (GRCm39) I108N possibly damaging Het
Cbs C A 17: 31,838,191 (GRCm39) V353L probably benign Het
Ceacam20 A G 7: 19,701,678 (GRCm39) T22A probably damaging Het
Ckap2l C T 2: 129,117,436 (GRCm39) E580K probably damaging Het
Ckmt1 T C 2: 121,189,374 (GRCm39) L15P possibly damaging Het
Clec18a G T 8: 111,808,204 (GRCm39) P66H probably benign Het
Cma1 G T 14: 56,180,120 (GRCm39) T95K probably benign Het
Csmd3 A G 15: 48,320,994 (GRCm39) V272A probably damaging Het
Ctnna3 A T 10: 64,670,368 (GRCm39) E632D probably benign Het
Ctsc T C 7: 87,946,361 (GRCm39) L130P probably damaging Het
Frmpd2 A T 14: 33,229,432 (GRCm39) R339S probably damaging Het
Frrs1 C A 3: 116,674,425 (GRCm39) S69* probably null Het
Gcc2 A T 10: 58,116,416 (GRCm39) E1108D probably benign Het
Gkn1 A T 6: 87,326,135 (GRCm39) probably null Het
Gtf2a1 A T 12: 91,534,498 (GRCm39) M252K probably benign Het
H2-Ob T C 17: 34,460,234 (GRCm39) F115S probably damaging Het
Ighv1-53 T C 12: 115,122,135 (GRCm39) N80S probably benign Het
Ighv1-67 T C 12: 115,567,666 (GRCm39) K82R probably benign Het
Ints1 A T 5: 139,747,828 (GRCm39) I1193N possibly damaging Het
Kmt2c A G 5: 25,549,923 (GRCm39) F1353L probably damaging Het
Luc7l C T 17: 26,472,219 (GRCm39) probably benign Het
Man1a A C 10: 53,796,331 (GRCm39) S454A possibly damaging Het
Mars2 C A 1: 55,277,222 (GRCm39) A275D probably damaging Het
Nrde2 A G 12: 100,097,178 (GRCm39) V874A probably benign Het
Ociad1 A G 5: 73,470,809 (GRCm39) T244A probably benign Het
Or10j2 A G 1: 173,097,811 (GRCm39) Y23C possibly damaging Het
Or3a10 A T 11: 73,935,589 (GRCm39) D170E possibly damaging Het
Or8c9 A T 9: 38,241,046 (GRCm39) L51F probably damaging Het
Ovca2 A G 11: 75,069,501 (GRCm39) C41R possibly damaging Het
Pacsin2 A T 15: 83,269,260 (GRCm39) D11E probably damaging Het
Pcdh15 G A 10: 74,178,441 (GRCm39) S566N possibly damaging Het
Pde3b A G 7: 114,135,297 (GRCm39) I1038M probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pkhd1 T A 1: 20,593,350 (GRCm39) T1588S possibly damaging Het
Ppig A G 2: 69,580,320 (GRCm39) D618G unknown Het
Pramel17 A G 4: 101,694,565 (GRCm39) F106S probably benign Het
Prorp G A 12: 55,351,200 (GRCm39) V170M possibly damaging Het
Ptpra T A 2: 130,386,417 (GRCm39) D622E probably damaging Het
Ptprs A T 17: 56,725,988 (GRCm39) F1431L probably benign Het
Pxdn A G 12: 30,044,479 (GRCm39) I486V probably benign Het
Rnpc3 G A 3: 113,422,004 (GRCm39) A77V probably benign Het
Rtl10 T A 16: 18,320,026 (GRCm39) C85* probably null Het
Skint10 A G 4: 112,586,170 (GRCm39) S149P probably benign Het
Slc17a8 A C 10: 89,412,275 (GRCm39) V570G probably benign Het
Slc25a42 A T 8: 70,642,148 (GRCm39) V98E probably damaging Het
Smco2 A G 6: 146,760,363 (GRCm39) E73G probably benign Het
Ss18 T C 18: 14,812,477 (GRCm39) Y38C probably damaging Het
Sspo T A 6: 48,453,540 (GRCm39) C2909* probably null Het
Tbccd1 A G 16: 22,652,747 (GRCm39) Y125H probably benign Het
Tdrd9 A G 12: 111,980,888 (GRCm39) T446A probably damaging Het
Tecta G T 9: 42,255,183 (GRCm39) Q1672K probably benign Het
Tek G C 4: 94,692,541 (GRCm39) W216C probably damaging Het
Timm17a C T 1: 135,241,313 (GRCm39) probably null Het
Tlr4 A T 4: 66,758,188 (GRCm39) H327L probably benign Het
Trim33 T C 3: 103,234,109 (GRCm39) I449T possibly damaging Het
Vmn1r57 A G 7: 5,223,559 (GRCm39) N28S probably null Het
Vmn2r117 T A 17: 23,696,177 (GRCm39) H410L probably damaging Het
Vmn2r16 A G 5: 109,508,772 (GRCm39) E500G probably damaging Het
Wif1 A G 10: 120,926,019 (GRCm39) N245S possibly damaging Het
Other mutations in Prss51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Prss51 APN 14 64,333,433 (GRCm39) missense probably damaging 1.00
PIT4354001:Prss51 UTSW 14 64,334,546 (GRCm39) missense probably damaging 0.99
R0453:Prss51 UTSW 14 64,334,588 (GRCm39) missense probably damaging 1.00
R1335:Prss51 UTSW 14 64,333,620 (GRCm39) critical splice donor site probably null
R1479:Prss51 UTSW 14 64,333,619 (GRCm39) critical splice donor site probably null
R3753:Prss51 UTSW 14 64,333,624 (GRCm39) splice site probably benign
R5384:Prss51 UTSW 14 64,334,543 (GRCm39) missense probably damaging 0.99
R5385:Prss51 UTSW 14 64,334,543 (GRCm39) missense probably damaging 0.99
R5386:Prss51 UTSW 14 64,334,543 (GRCm39) missense probably damaging 0.99
R6522:Prss51 UTSW 14 64,334,855 (GRCm39) missense possibly damaging 0.90
R6722:Prss51 UTSW 14 64,332,508 (GRCm39) missense probably damaging 0.99
R6908:Prss51 UTSW 14 64,333,601 (GRCm39) missense probably benign 0.00
R6919:Prss51 UTSW 14 64,334,937 (GRCm39) missense probably damaging 1.00
R7510:Prss51 UTSW 14 64,333,489 (GRCm39) missense probably damaging 1.00
R7711:Prss51 UTSW 14 64,334,937 (GRCm39) missense probably damaging 1.00
R7753:Prss51 UTSW 14 64,333,376 (GRCm39) missense possibly damaging 0.86
R9000:Prss51 UTSW 14 64,332,420 (GRCm39) missense possibly damaging 0.95
R9164:Prss51 UTSW 14 64,334,958 (GRCm39) missense probably damaging 1.00
R9613:Prss51 UTSW 14 64,332,461 (GRCm39) missense possibly damaging 0.65
X0024:Prss51 UTSW 14 64,334,915 (GRCm39) missense probably damaging 1.00
Z1177:Prss51 UTSW 14 64,332,390 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTACTTAGTGGTGAGTTCTACTG -3'
(R):5'- CATTTTGCTCAGCAGAGGGC -3'

Sequencing Primer
(F):5'- GTTTGGGATGTGTCTTCACCCAC -3'
(R):5'- GCACATACCATGGCCATGAGTATATG -3'
Posted On 2019-06-26