Incidental Mutation 'R7221:Cntrl'
ID561786
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Namecentriolin
Synonyms6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R7221 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location35109492-35178822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35151857 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1214 (F1214I)
Ref Sequence ENSEMBL: ENSMUSP00000108655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113033] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000156933] [ENSMUST00000201787]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028237
AA Change: F1215I

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: F1215I

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113032
AA Change: F1214I

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: F1214I

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113033
SMART Domains Protein: ENSMUSP00000108656
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113034
AA Change: F662I

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110
AA Change: F662I

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.68e-5 PROSPERO
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
coiled coil region 445 549 N/A INTRINSIC
internal_repeat_1 566 579 1.52e-6 PROSPERO
internal_repeat_2 568 596 2.75e-5 PROSPERO
low complexity region 600 608 N/A INTRINSIC
internal_repeat_2 626 653 2.75e-5 PROSPERO
low complexity region 715 748 N/A INTRINSIC
coiled coil region 767 1076 N/A INTRINSIC
internal_repeat_3 1095 1112 5.68e-5 PROSPERO
low complexity region 1184 1224 N/A INTRINSIC
low complexity region 1344 1356 N/A INTRINSIC
low complexity region 1366 1388 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1421 1432 N/A INTRINSIC
low complexity region 1640 1655 N/A INTRINSIC
internal_repeat_1 1699 1712 1.52e-6 PROSPERO
low complexity region 1736 1754 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113037
AA Change: F661I

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110
AA Change: F661I

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123884
SMART Domains Protein: ENSMUSP00000119760
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 37 400 N/A INTRINSIC
coiled coil region 458 571 N/A INTRINSIC
low complexity region 576 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156933
AA Change: F1215I

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: F1215I

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201787
SMART Domains Protein: ENSMUSP00000143914
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 9 71 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,475,001 D232A possibly damaging Het
Abr A C 11: 76,423,161 M720R probably benign Het
Acad10 G A 5: 121,630,210 T761M probably damaging Het
Agxt G T 1: 93,137,901 G164V possibly damaging Het
Ankar C T 1: 72,650,231 G1247D probably damaging Het
Bptf A C 11: 107,054,832 L2527R probably damaging Het
Brinp2 T C 1: 158,266,547 H195R possibly damaging Het
C130079G13Rik A G 3: 59,928,933 probably benign Het
Cacna2d4 G T 6: 119,236,663 R14S probably benign Het
Cep126 A T 9: 8,100,987 C515* probably null Het
Chia1 A T 3: 106,131,920 N442I probably damaging Het
Clasp2 A G 9: 113,852,757 D327G probably damaging Het
Cnbd2 T C 2: 156,373,661 F519L probably benign Het
Cul9 A T 17: 46,528,565 M829K probably damaging Het
Cyp4b1 T C 4: 115,635,978 Q223R possibly damaging Het
Defb37 A T 8: 18,990,972 M1K probably null Het
Dnah7c A T 1: 46,455,777 Q55L possibly damaging Het
Eif2b4 A T 5: 31,187,787 D463E possibly damaging Het
Elovl1 C T 4: 118,431,614 H167Y probably damaging Het
Emb T A 13: 117,267,477 L255Q probably damaging Het
Eogt T C 6: 97,112,724 Y465C probably damaging Het
Erc2 A G 14: 27,653,158 H111R probably damaging Het
Fam234b T C 6: 135,228,531 F498S probably damaging Het
Fgfr3 GAGGCTGGCAGCGTGTACGCAGGC GAGGC 5: 33,732,748 probably null Het
Flrt3 T A 2: 140,661,170 E179D probably damaging Het
Fndc3a T C 14: 72,556,157 R993G probably benign Het
Gm11639 A G 11: 104,900,606 N2882S probably benign Het
Gm13762 A G 2: 88,973,153 V246A probably damaging Het
Gm14325 T C 2: 177,834,610 T14A probably damaging Het
Gm5464 T A 14: 66,869,232 V106D unknown Het
Gm7697 T G 8: 69,522,664 D50A probably benign Het
Gpatch11 T A 17: 78,842,117 I182N possibly damaging Het
Grm6 A G 11: 50,863,043 R725G probably damaging Het
Hap1 A T 11: 100,348,829 M588K probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ints8 A G 4: 11,225,613 M648T probably benign Het
Ipo11 A T 13: 106,892,557 L296Q probably damaging Het
Kirrel G A 3: 87,086,397 Q518* probably null Het
Krt18 G T 15: 102,029,532 D155Y possibly damaging Het
Lctl A T 9: 64,118,935 K91* probably null Het
Marf1 C A 16: 14,142,485 R565L probably damaging Het
Med13 A T 11: 86,288,095 D1458E probably benign Het
Mroh8 T A 2: 157,229,917 Y556F probably benign Het
Muc16 C T 9: 18,642,199 G4266D probably benign Het
Nsrp1 A T 11: 77,048,423 F182I probably damaging Het
Obox3 A T 7: 15,626,058 Y229N probably benign Het
Olfr1184 T A 2: 88,487,629 V299D probably damaging Het
Olfr124 A G 17: 37,805,561 K139E probably benign Het
Olfr1247 T C 2: 89,609,928 Y58C probably damaging Het
Olfr1359 T C 13: 21,703,102 S34P probably damaging Het
Olfr26 A G 9: 38,855,242 Y60C probably damaging Het
Olfr746 A T 14: 50,654,071 Y278F probably damaging Het
Pabpc2 T A 18: 39,773,910 V76D possibly damaging Het
Parp9 T C 16: 35,953,701 W348R probably benign Het
Pdp1 T C 4: 11,961,004 T455A probably damaging Het
Phactr2 A C 10: 13,247,039 D446E possibly damaging Het
Pi4kb T C 3: 94,994,189 L389P probably damaging Het
Pla2g4f C T 2: 120,300,995 R749H probably benign Het
Plec A G 15: 76,175,774 V3321A probably damaging Het
Plod2 T C 9: 92,584,527 V180A probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Rubcn T C 16: 32,866,923 probably null Het
Sacs T C 14: 61,208,806 V2767A probably damaging Het
Selenbp2 C G 3: 94,703,826 Y414* probably null Het
Slc45a4 A T 15: 73,586,410 M430K probably benign Het
Smg1 A G 7: 118,182,797 L1145P possibly damaging Het
Spns2 A G 11: 72,456,916 V316A probably benign Het
Srl T A 16: 4,482,947 E753D probably damaging Het
Thada T C 17: 84,464,366 T23A possibly damaging Het
Tmem231 T C 8: 111,933,676 T31A probably benign Het
Tpr C T 1: 150,446,178 T2321M possibly damaging Het
Ttn T A 2: 76,941,851 N2615I unknown Het
Vmn1r41 A G 6: 89,747,052 I192V probably benign Het
Vmn2r83 A T 10: 79,480,167 T466S probably benign Het
Vnn1 A G 10: 23,895,054 D60G probably benign Het
Wiz G A 17: 32,359,165 P449S probably benign Het
Zic1 A G 9: 91,364,732 S96P probably damaging Het
Zw10 T A 9: 49,069,712 S471T probably benign Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35137814 splice site probably benign
IGL00478:Cntrl APN 2 35160601 missense probably damaging 0.98
IGL01460:Cntrl APN 2 35165844 missense probably benign 0.04
IGL01556:Cntrl APN 2 35173059 missense probably benign 0.19
IGL02155:Cntrl APN 2 35160238 splice site probably benign
IGL02419:Cntrl APN 2 35134043 missense probably damaging 0.97
PIT4480001:Cntrl UTSW 2 35155428 missense probably damaging 0.96
R0179:Cntrl UTSW 2 35167859 missense probably benign 0.00
R0276:Cntrl UTSW 2 35151732 missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35127380 missense probably benign 0.41
R0755:Cntrl UTSW 2 35145139 missense probably damaging 1.00
R0763:Cntrl UTSW 2 35171066 missense probably benign
R0781:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35175095 splice site probably benign
R1067:Cntrl UTSW 2 35149022 unclassified probably benign
R1110:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35127973 missense probably damaging 1.00
R1457:Cntrl UTSW 2 35122756 missense probably benign 0.00
R1472:Cntrl UTSW 2 35169317 critical splice donor site probably null
R1522:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R1702:Cntrl UTSW 2 35171836 critical splice acceptor site probably null
R1762:Cntrl UTSW 2 35122806 frame shift probably null
R1785:Cntrl UTSW 2 35122806 frame shift probably null
R1786:Cntrl UTSW 2 35122806 frame shift probably null
R1812:Cntrl UTSW 2 35149469 missense probably damaging 0.97
R1854:Cntrl UTSW 2 35122684 missense probably damaging 1.00
R1863:Cntrl UTSW 2 35118119 missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35129815 missense probably benign 0.03
R1914:Cntrl UTSW 2 35162861 missense probably benign 0.00
R1915:Cntrl UTSW 2 35162861 missense probably benign 0.00
R2049:Cntrl UTSW 2 35122806 frame shift probably null
R2118:Cntrl UTSW 2 35161965 missense probably benign 0.31
R2140:Cntrl UTSW 2 35122806 frame shift probably null
R2142:Cntrl UTSW 2 35122806 frame shift probably null
R2203:Cntrl UTSW 2 35143737 missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35127513 missense probably benign 0.00
R2349:Cntrl UTSW 2 35176251 missense probably benign 0.18
R2374:Cntrl UTSW 2 35153276 missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35145100 missense probably damaging 1.00
R3890:Cntrl UTSW 2 35170480 missense probably benign 0.02
R3911:Cntrl UTSW 2 35120049 missense probably damaging 1.00
R3922:Cntrl UTSW 2 35129739 missense probably damaging 0.98
R4081:Cntrl UTSW 2 35161926 splice site probably benign
R4081:Cntrl UTSW 2 35175125 missense probably damaging 1.00
R4516:Cntrl UTSW 2 35127981 missense probably benign 0.00
R4518:Cntrl UTSW 2 35148974 missense probably damaging 1.00
R4519:Cntrl UTSW 2 35173111 missense probably damaging 1.00
R4646:Cntrl UTSW 2 35149461 missense probably damaging 0.99
R4753:Cntrl UTSW 2 35153439 missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35175551 missense probably damaging 1.00
R4916:Cntrl UTSW 2 35165682 missense probably benign 0.42
R5168:Cntrl UTSW 2 35157655 missense probably damaging 1.00
R5291:Cntrl UTSW 2 35134060 missense probably damaging 1.00
R5356:Cntrl UTSW 2 35148899 nonsense probably null
R5774:Cntrl UTSW 2 35162861 missense probably benign 0.15
R5947:Cntrl UTSW 2 35116679 missense probably damaging 1.00
R6144:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35129634 missense probably benign 0.10
R6267:Cntrl UTSW 2 35129793 missense probably damaging 1.00
R6332:Cntrl UTSW 2 35128024 missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35162848 missense probably benign 0.05
R6487:Cntrl UTSW 2 35122682 missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35135572 missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35170646 missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35149491 missense probably damaging 1.00
R6853:Cntrl UTSW 2 35129821 missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35162095 critical splice donor site probably null
R6965:Cntrl UTSW 2 35162833 missense probably benign 0.20
R6970:Cntrl UTSW 2 35118137 missense probably benign
R7085:Cntrl UTSW 2 35165792 missense probably benign 0.00
R7150:Cntrl UTSW 2 35165445 critical splice acceptor site probably null
R7213:Cntrl UTSW 2 35135680 missense possibly damaging 0.95
R7389:Cntrl UTSW 2 35127517 missense probably benign 0.01
R7414:Cntrl UTSW 2 35165467 missense probably benign 0.02
R7427:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7428:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7453:Cntrl UTSW 2 35155409 missense possibly damaging 0.89
R7747:Cntrl UTSW 2 35116798 missense probably damaging 1.00
R7753:Cntrl UTSW 2 35111679 missense probably damaging 1.00
R7811:Cntrl UTSW 2 35162861 missense probably benign 0.00
R7882:Cntrl UTSW 2 35170580 missense probably benign 0.41
R7965:Cntrl UTSW 2 35170580 missense probably benign 0.41
RF007:Cntrl UTSW 2 35170500 missense probably benign
RF016:Cntrl UTSW 2 35119986 missense probably benign
RF017:Cntrl UTSW 2 35175189 missense probably damaging 0.96
X0024:Cntrl UTSW 2 35147296 missense probably damaging 1.00
X0026:Cntrl UTSW 2 35149516 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35157768 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35165682 missense probably benign 0.08
X0028:Cntrl UTSW 2 35147344 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATAGTTCTCAGGCCACCAAGG -3'
(R):5'- GCTGCAGGTATCTATAGATCAGCAG -3'

Sequencing Primer
(F):5'- ACCAAGGACTCCGGTTTGG -3'
(R):5'- TTGACTCCAAAGTAGCTGTGACC -3'
Posted On2019-06-26