Incidental Mutation 'R7221:Ints8'
ID561803
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Nameintegrator complex subunit 8
Synonyms2810013E07Rik, D130008D20Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7221 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11199158-11254258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11225613 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 648 (M648T)
Ref Sequence ENSEMBL: ENSMUSP00000038418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
Predicted Effect probably benign
Transcript: ENSMUST00000044616
AA Change: M648T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: M648T

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108318
AA Change: M648T

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: M648T

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108319
AA Change: M648T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: M648T

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,475,001 D232A possibly damaging Het
Abr A C 11: 76,423,161 M720R probably benign Het
Acad10 G A 5: 121,630,210 T761M probably damaging Het
Agxt G T 1: 93,137,901 G164V possibly damaging Het
Ankar C T 1: 72,650,231 G1247D probably damaging Het
Bptf A C 11: 107,054,832 L2527R probably damaging Het
Brinp2 T C 1: 158,266,547 H195R possibly damaging Het
C130079G13Rik A G 3: 59,928,933 probably benign Het
Cacna2d4 G T 6: 119,236,663 R14S probably benign Het
Cep126 A T 9: 8,100,987 C515* probably null Het
Chia1 A T 3: 106,131,920 N442I probably damaging Het
Clasp2 A G 9: 113,852,757 D327G probably damaging Het
Cnbd2 T C 2: 156,373,661 F519L probably benign Het
Cntrl T A 2: 35,151,857 F1214I possibly damaging Het
Cul9 A T 17: 46,528,565 M829K probably damaging Het
Cyp4b1 T C 4: 115,635,978 Q223R possibly damaging Het
Defb37 A T 8: 18,990,972 M1K probably null Het
Dnah7c A T 1: 46,455,777 Q55L possibly damaging Het
Eif2b4 A T 5: 31,187,787 D463E possibly damaging Het
Elovl1 C T 4: 118,431,614 H167Y probably damaging Het
Emb T A 13: 117,267,477 L255Q probably damaging Het
Eogt T C 6: 97,112,724 Y465C probably damaging Het
Erc2 A G 14: 27,653,158 H111R probably damaging Het
Fam234b T C 6: 135,228,531 F498S probably damaging Het
Fgfr3 GAGGCTGGCAGCGTGTACGCAGGC GAGGC 5: 33,732,748 probably null Het
Flrt3 T A 2: 140,661,170 E179D probably damaging Het
Fndc3a T C 14: 72,556,157 R993G probably benign Het
Gm11639 A G 11: 104,900,606 N2882S probably benign Het
Gm13762 A G 2: 88,973,153 V246A probably damaging Het
Gm14325 T C 2: 177,834,610 T14A probably damaging Het
Gm5464 T A 14: 66,869,232 V106D unknown Het
Gm7697 T G 8: 69,522,664 D50A probably benign Het
Gpatch11 T A 17: 78,842,117 I182N possibly damaging Het
Grm6 A G 11: 50,863,043 R725G probably damaging Het
Hap1 A T 11: 100,348,829 M588K probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ipo11 A T 13: 106,892,557 L296Q probably damaging Het
Kirrel G A 3: 87,086,397 Q518* probably null Het
Krt18 G T 15: 102,029,532 D155Y possibly damaging Het
Lctl A T 9: 64,118,935 K91* probably null Het
Marf1 C A 16: 14,142,485 R565L probably damaging Het
Med13 A T 11: 86,288,095 D1458E probably benign Het
Mroh8 T A 2: 157,229,917 Y556F probably benign Het
Muc16 C T 9: 18,642,199 G4266D probably benign Het
Nsrp1 A T 11: 77,048,423 F182I probably damaging Het
Obox3 A T 7: 15,626,058 Y229N probably benign Het
Olfr1184 T A 2: 88,487,629 V299D probably damaging Het
Olfr124 A G 17: 37,805,561 K139E probably benign Het
Olfr1247 T C 2: 89,609,928 Y58C probably damaging Het
Olfr1359 T C 13: 21,703,102 S34P probably damaging Het
Olfr26 A G 9: 38,855,242 Y60C probably damaging Het
Olfr746 A T 14: 50,654,071 Y278F probably damaging Het
Pabpc2 T A 18: 39,773,910 V76D possibly damaging Het
Parp9 T C 16: 35,953,701 W348R probably benign Het
Pdp1 T C 4: 11,961,004 T455A probably damaging Het
Phactr2 A C 10: 13,247,039 D446E possibly damaging Het
Pi4kb T C 3: 94,994,189 L389P probably damaging Het
Pla2g4f C T 2: 120,300,995 R749H probably benign Het
Plec A G 15: 76,175,774 V3321A probably damaging Het
Plod2 T C 9: 92,584,527 V180A probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Rubcn T C 16: 32,866,923 probably null Het
Sacs T C 14: 61,208,806 V2767A probably damaging Het
Selenbp2 C G 3: 94,703,826 Y414* probably null Het
Slc45a4 A T 15: 73,586,410 M430K probably benign Het
Smg1 A G 7: 118,182,797 L1145P possibly damaging Het
Spns2 A G 11: 72,456,916 V316A probably benign Het
Srl T A 16: 4,482,947 E753D probably damaging Het
Thada T C 17: 84,464,366 T23A possibly damaging Het
Tmem231 T C 8: 111,933,676 T31A probably benign Het
Tpr C T 1: 150,446,178 T2321M possibly damaging Het
Ttn T A 2: 76,941,851 N2615I unknown Het
Vmn1r41 A G 6: 89,747,052 I192V probably benign Het
Vmn2r83 A T 10: 79,480,167 T466S probably benign Het
Vnn1 A G 10: 23,895,054 D60G probably benign Het
Wiz G A 17: 32,359,165 P449S probably benign Het
Zic1 A G 9: 91,364,732 S96P probably damaging Het
Zw10 T A 9: 49,069,712 S471T probably benign Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11218679 splice site probably benign
IGL01925:Ints8 APN 4 11235617 splice site probably benign
IGL02195:Ints8 APN 4 11221222 missense probably damaging 1.00
IGL02215:Ints8 APN 4 11209244 missense probably damaging 1.00
IGL02429:Ints8 APN 4 11231720 missense probably damaging 1.00
IGL02484:Ints8 APN 4 11208834 nonsense probably null
IGL02558:Ints8 APN 4 11218771 missense probably damaging 1.00
IGL02725:Ints8 APN 4 11239406 missense probably benign 0.01
IGL02742:Ints8 APN 4 11241627 missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11245896 missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11235565 missense probably damaging 1.00
IGL03171:Ints8 APN 4 11231702 missense probably benign 0.01
IGL03335:Ints8 APN 4 11216460 missense probably damaging 1.00
P0026:Ints8 UTSW 4 11225788 nonsense probably null
R0054:Ints8 UTSW 4 11204595 utr 3 prime probably benign
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0184:Ints8 UTSW 4 11218637 missense probably benign 0.03
R0299:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0499:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0540:Ints8 UTSW 4 11252926 missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11246097 missense probably benign 0.04
R1232:Ints8 UTSW 4 11234587 missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11221204 missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11239461 missense probably benign 0.22
R1503:Ints8 UTSW 4 11245842 missense probably damaging 0.97
R1587:Ints8 UTSW 4 11245722 critical splice donor site probably null
R1701:Ints8 UTSW 4 11231656 missense probably damaging 1.00
R1721:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1757:Ints8 UTSW 4 11254109 start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11225600 critical splice donor site probably null
R1867:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1868:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1952:Ints8 UTSW 4 11221150 missense probably benign 0.21
R2084:Ints8 UTSW 4 11230377 missense probably benign 0.31
R2108:Ints8 UTSW 4 11235552 missense probably damaging 0.99
R2202:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11225725 missense probably benign 0.29
R2504:Ints8 UTSW 4 11241642 missense probably benign 0.03
R3824:Ints8 UTSW 4 11225621 nonsense probably null
R4664:Ints8 UTSW 4 11227152 missense probably benign 0.04
R4703:Ints8 UTSW 4 11223785 missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11230367 nonsense probably null
R5206:Ints8 UTSW 4 11216477 missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11211916 missense probably damaging 1.00
R5505:Ints8 UTSW 4 11221143 missense probably benign 0.18
R5513:Ints8 UTSW 4 11248303 missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11241654 missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11223813 missense probably damaging 1.00
R6007:Ints8 UTSW 4 11208845 missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11252891 missense probably damaging 1.00
R6466:Ints8 UTSW 4 11252878 missense probably damaging 0.99
R6709:Ints8 UTSW 4 11221117 missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11204474 missense probably damaging 1.00
R6998:Ints8 UTSW 4 11204537 missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11204574 missense possibly damaging 0.82
R7772:Ints8 UTSW 4 11227190 missense probably damaging 0.97
R7872:Ints8 UTSW 4 11254062 missense probably benign 0.00
R7955:Ints8 UTSW 4 11254062 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAAGAAAGTTTCTCCCGTTACC -3'
(R):5'- GAGGATTGACTGCCTGTTCTC -3'

Sequencing Primer
(F):5'- GAAAGTTTCTCCCGTTACCAATATTC -3'
(R):5'- GGACTTTCCTCACTCCAAACAG -3'
Posted On2019-06-26