Incidental Mutation 'R7221:Pdp1'
ID561804
Institutional Source Beutler Lab
Gene Symbol Pdp1
Ensembl Gene ENSMUSG00000049225
Gene Namepyruvate dehyrogenase phosphatase catalytic subunit 1
SynonymsLOC381511, Ppm2c
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7221 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11958184-11966452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11961004 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 455 (T455A)
Ref Sequence ENSEMBL: ENSMUSP00000103936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056050] [ENSMUST00000095144] [ENSMUST00000108297] [ENSMUST00000108299] [ENSMUST00000108301] [ENSMUST00000108302]
Predicted Effect probably damaging
Transcript: ENSMUST00000056050
AA Change: T396A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050521
Gene: ENSMUSG00000049225
AA Change: T396A

DomainStartEndE-ValueType
PP2Cc 99 523 3.36e-97 SMART
PP2C_SIG 177 525 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095144
AA Change: T421A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092766
Gene: ENSMUSG00000049225
AA Change: T421A

DomainStartEndE-ValueType
PP2Cc 124 548 3.36e-97 SMART
PP2C_SIG 202 550 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108297
AA Change: T396A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103932
Gene: ENSMUSG00000049225
AA Change: T396A

DomainStartEndE-ValueType
PP2Cc 99 523 3.36e-97 SMART
PP2C_SIG 177 525 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108299
AA Change: T421A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103934
Gene: ENSMUSG00000049225
AA Change: T421A

DomainStartEndE-ValueType
PP2Cc 124 548 3.36e-97 SMART
PP2C_SIG 202 550 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108301
AA Change: T455A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103936
Gene: ENSMUSG00000049225
AA Change: T455A

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
PP2Cc 158 582 3.36e-97 SMART
PP2C_SIG 236 584 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108302
AA Change: T436A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103937
Gene: ENSMUSG00000049225
AA Change: T436A

DomainStartEndE-ValueType
PP2Cc 139 563 3.36e-97 SMART
PP2C_SIG 217 565 2.77e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (E1) is one of the three components (E1, E2, and E3) of the large pyruvate dehydrogenase complex. Pyruvate dehydrogenase kinases catalyze phosphorylation of serine residues of E1 to inactivate the E1 component and inhibit the complex. Pyruvate dehydrogenase phosphatases catalyze the dephosphorylation and activation of the E1 component to reverse the effects of pyruvate dehydrogenase kinases. Pyruvate dehydrogenase phosphatase is a heterodimer consisting of catalytic and regulatory subunits. Two catalytic subunits have been reported; one is predominantly expressed in skeletal muscle and another one is is much more abundant in the liver. The catalytic subunit, encoded by this gene, is the former, and belongs to the protein phosphatase 2C (PP2C) superfamily. Along with the pyruvate dehydrogenase complex and pyruvate dehydrogenase kinases, this enzyme is located in the mitochondrial matrix. Mutation in this gene causes pyruvate dehydrogenase phosphatase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,475,001 D232A possibly damaging Het
Abr A C 11: 76,423,161 M720R probably benign Het
Acad10 G A 5: 121,630,210 T761M probably damaging Het
Agxt G T 1: 93,137,901 G164V possibly damaging Het
Ankar C T 1: 72,650,231 G1247D probably damaging Het
Bptf A C 11: 107,054,832 L2527R probably damaging Het
Brinp2 T C 1: 158,266,547 H195R possibly damaging Het
C130079G13Rik A G 3: 59,928,933 probably benign Het
Cacna2d4 G T 6: 119,236,663 R14S probably benign Het
Cep126 A T 9: 8,100,987 C515* probably null Het
Chia1 A T 3: 106,131,920 N442I probably damaging Het
Clasp2 A G 9: 113,852,757 D327G probably damaging Het
Cnbd2 T C 2: 156,373,661 F519L probably benign Het
Cntrl T A 2: 35,151,857 F1214I possibly damaging Het
Cul9 A T 17: 46,528,565 M829K probably damaging Het
Cyp4b1 T C 4: 115,635,978 Q223R possibly damaging Het
Defb37 A T 8: 18,990,972 M1K probably null Het
Dnah7c A T 1: 46,455,777 Q55L possibly damaging Het
Eif2b4 A T 5: 31,187,787 D463E possibly damaging Het
Elovl1 C T 4: 118,431,614 H167Y probably damaging Het
Emb T A 13: 117,267,477 L255Q probably damaging Het
Eogt T C 6: 97,112,724 Y465C probably damaging Het
Erc2 A G 14: 27,653,158 H111R probably damaging Het
Fam234b T C 6: 135,228,531 F498S probably damaging Het
Fgfr3 GAGGCTGGCAGCGTGTACGCAGGC GAGGC 5: 33,732,748 probably null Het
Flrt3 T A 2: 140,661,170 E179D probably damaging Het
Fndc3a T C 14: 72,556,157 R993G probably benign Het
Gm11639 A G 11: 104,900,606 N2882S probably benign Het
Gm13762 A G 2: 88,973,153 V246A probably damaging Het
Gm14325 T C 2: 177,834,610 T14A probably damaging Het
Gm5464 T A 14: 66,869,232 V106D unknown Het
Gm7697 T G 8: 69,522,664 D50A probably benign Het
Gpatch11 T A 17: 78,842,117 I182N possibly damaging Het
Grm6 A G 11: 50,863,043 R725G probably damaging Het
Hap1 A T 11: 100,348,829 M588K probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ints8 A G 4: 11,225,613 M648T probably benign Het
Ipo11 A T 13: 106,892,557 L296Q probably damaging Het
Kirrel G A 3: 87,086,397 Q518* probably null Het
Krt18 G T 15: 102,029,532 D155Y possibly damaging Het
Lctl A T 9: 64,118,935 K91* probably null Het
Marf1 C A 16: 14,142,485 R565L probably damaging Het
Med13 A T 11: 86,288,095 D1458E probably benign Het
Mroh8 T A 2: 157,229,917 Y556F probably benign Het
Muc16 C T 9: 18,642,199 G4266D probably benign Het
Nsrp1 A T 11: 77,048,423 F182I probably damaging Het
Obox3 A T 7: 15,626,058 Y229N probably benign Het
Olfr1184 T A 2: 88,487,629 V299D probably damaging Het
Olfr124 A G 17: 37,805,561 K139E probably benign Het
Olfr1247 T C 2: 89,609,928 Y58C probably damaging Het
Olfr1359 T C 13: 21,703,102 S34P probably damaging Het
Olfr26 A G 9: 38,855,242 Y60C probably damaging Het
Olfr746 A T 14: 50,654,071 Y278F probably damaging Het
Pabpc2 T A 18: 39,773,910 V76D possibly damaging Het
Parp9 T C 16: 35,953,701 W348R probably benign Het
Phactr2 A C 10: 13,247,039 D446E possibly damaging Het
Pi4kb T C 3: 94,994,189 L389P probably damaging Het
Pla2g4f C T 2: 120,300,995 R749H probably benign Het
Plec A G 15: 76,175,774 V3321A probably damaging Het
Plod2 T C 9: 92,584,527 V180A probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Rubcn T C 16: 32,866,923 probably null Het
Sacs T C 14: 61,208,806 V2767A probably damaging Het
Selenbp2 C G 3: 94,703,826 Y414* probably null Het
Slc45a4 A T 15: 73,586,410 M430K probably benign Het
Smg1 A G 7: 118,182,797 L1145P possibly damaging Het
Spns2 A G 11: 72,456,916 V316A probably benign Het
Srl T A 16: 4,482,947 E753D probably damaging Het
Thada T C 17: 84,464,366 T23A possibly damaging Het
Tmem231 T C 8: 111,933,676 T31A probably benign Het
Tpr C T 1: 150,446,178 T2321M possibly damaging Het
Ttn T A 2: 76,941,851 N2615I unknown Het
Vmn1r41 A G 6: 89,747,052 I192V probably benign Het
Vmn2r83 A T 10: 79,480,167 T466S probably benign Het
Vnn1 A G 10: 23,895,054 D60G probably benign Het
Wiz G A 17: 32,359,165 P449S probably benign Het
Zic1 A G 9: 91,364,732 S96P probably damaging Het
Zw10 T A 9: 49,069,712 S471T probably benign Het
Other mutations in Pdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02243:Pdp1 APN 4 11961873 missense probably benign 0.20
IGL02643:Pdp1 APN 4 11962062 missense probably benign
R1931:Pdp1 UTSW 4 11962074 missense probably benign 0.01
R2162:Pdp1 UTSW 4 11961123 missense probably damaging 0.98
R2418:Pdp1 UTSW 4 11961838 missense probably damaging 0.98
R3843:Pdp1 UTSW 4 11961961 missense probably benign 0.00
R5699:Pdp1 UTSW 4 11960907 missense possibly damaging 0.79
R6479:Pdp1 UTSW 4 11961327 missense probably damaging 1.00
R7263:Pdp1 UTSW 4 11960821 missense possibly damaging 0.82
Z1177:Pdp1 UTSW 4 11961639 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGTCCCAGAGTCACCTTGTACC -3'
(R):5'- CGTCTGAAACTGGAACACCC -3'

Sequencing Primer
(F):5'- TGTACCCACCAACTGCTATTG -3'
(R):5'- GCCAAGAGCGTGGTAAAGC -3'
Posted On2019-06-26