Incidental Mutation 'R7221:Fam234b'
ID 561813
Institutional Source Beutler Lab
Gene Symbol Fam234b
Ensembl Gene ENSMUSG00000030207
Gene Name family with sequence similarity 234, member B
Synonyms 8430419L09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7221 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 135197977-135244955 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135228531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 498 (F498S)
Ref Sequence ENSEMBL: ENSMUSP00000107547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111915] [ENSMUST00000111916]
AlphaFold Q8BYI8
Predicted Effect probably damaging
Transcript: ENSMUST00000111915
AA Change: F498S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107546
Gene: ENSMUSG00000030207
AA Change: F498S

transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111916
AA Change: F498S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107547
Gene: ENSMUSG00000030207
AA Change: F498S

transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,475,001 D232A possibly damaging Het
Abr A C 11: 76,423,161 M720R probably benign Het
Acad10 G A 5: 121,630,210 T761M probably damaging Het
Agxt G T 1: 93,137,901 G164V possibly damaging Het
Ankar C T 1: 72,650,231 G1247D probably damaging Het
Bptf A C 11: 107,054,832 L2527R probably damaging Het
Brinp2 T C 1: 158,266,547 H195R possibly damaging Het
C130079G13Rik A G 3: 59,928,933 probably benign Het
Cacna2d4 G T 6: 119,236,663 R14S probably benign Het
Cep126 A T 9: 8,100,987 C515* probably null Het
Chia1 A T 3: 106,131,920 N442I probably damaging Het
Clasp2 A G 9: 113,852,757 D327G probably damaging Het
Cnbd2 T C 2: 156,373,661 F519L probably benign Het
Cntrl T A 2: 35,151,857 F1214I possibly damaging Het
Cul9 A T 17: 46,528,565 M829K probably damaging Het
Cyp4b1 T C 4: 115,635,978 Q223R possibly damaging Het
Defb37 A T 8: 18,990,972 M1K probably null Het
Dnah7c A T 1: 46,455,777 Q55L possibly damaging Het
Eif2b4 A T 5: 31,187,787 D463E possibly damaging Het
Elovl1 C T 4: 118,431,614 H167Y probably damaging Het
Emb T A 13: 117,267,477 L255Q probably damaging Het
Eogt T C 6: 97,112,724 Y465C probably damaging Het
Erc2 A G 14: 27,653,158 H111R probably damaging Het
Fgfr3 GAGGCTGGCAGCGTGTACGCAGGC GAGGC 5: 33,732,748 probably null Het
Flrt3 T A 2: 140,661,170 E179D probably damaging Het
Fndc3a T C 14: 72,556,157 R993G probably benign Het
Gm11639 A G 11: 104,900,606 N2882S probably benign Het
Gm13762 A G 2: 88,973,153 V246A probably damaging Het
Gm14325 T C 2: 177,834,610 T14A probably damaging Het
Gm5464 T A 14: 66,869,232 V106D unknown Het
Gm7697 T G 8: 69,522,664 D50A probably benign Het
Gpatch11 T A 17: 78,842,117 I182N possibly damaging Het
Grm6 A G 11: 50,863,043 R725G probably damaging Het
Hap1 A T 11: 100,348,829 M588K probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ints8 A G 4: 11,225,613 M648T probably benign Het
Ipo11 A T 13: 106,892,557 L296Q probably damaging Het
Kirrel G A 3: 87,086,397 Q518* probably null Het
Krt18 G T 15: 102,029,532 D155Y possibly damaging Het
Lctl A T 9: 64,118,935 K91* probably null Het
Marf1 C A 16: 14,142,485 R565L probably damaging Het
Med13 A T 11: 86,288,095 D1458E probably benign Het
Mroh8 T A 2: 157,229,917 Y556F probably benign Het
Muc16 C T 9: 18,642,199 G4266D probably benign Het
Nsrp1 A T 11: 77,048,423 F182I probably damaging Het
Obox3 A T 7: 15,626,058 Y229N probably benign Het
Olfr1184 T A 2: 88,487,629 V299D probably damaging Het
Olfr124 A G 17: 37,805,561 K139E probably benign Het
Olfr1247 T C 2: 89,609,928 Y58C probably damaging Het
Olfr1359 T C 13: 21,703,102 S34P probably damaging Het
Olfr26 A G 9: 38,855,242 Y60C probably damaging Het
Olfr746 A T 14: 50,654,071 Y278F probably damaging Het
Pabpc2 T A 18: 39,773,910 V76D possibly damaging Het
Parp9 T C 16: 35,953,701 W348R probably benign Het
Pdp1 T C 4: 11,961,004 T455A probably damaging Het
Phactr2 A C 10: 13,247,039 D446E possibly damaging Het
Pi4kb T C 3: 94,994,189 L389P probably damaging Het
Pla2g4f C T 2: 120,300,995 R749H probably benign Het
Plec A G 15: 76,175,774 V3321A probably damaging Het
Plod2 T C 9: 92,584,527 V180A probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Rubcn T C 16: 32,866,923 probably null Het
Sacs T C 14: 61,208,806 V2767A probably damaging Het
Selenbp2 C G 3: 94,703,826 Y414* probably null Het
Slc45a4 A T 15: 73,586,410 M430K probably benign Het
Smg1 A G 7: 118,182,797 L1145P possibly damaging Het
Spns2 A G 11: 72,456,916 V316A probably benign Het
Srl T A 16: 4,482,947 E753D probably damaging Het
Thada T C 17: 84,464,366 T23A possibly damaging Het
Tmem231 T C 8: 111,933,676 T31A probably benign Het
Tpr C T 1: 150,446,178 T2321M possibly damaging Het
Ttn T A 2: 76,941,851 N2615I unknown Het
Vmn1r41 A G 6: 89,747,052 I192V probably benign Het
Vmn2r83 A T 10: 79,480,167 T466S probably benign Het
Vnn1 A G 10: 23,895,054 D60G probably benign Het
Wiz G A 17: 32,359,165 P449S probably benign Het
Zic1 A G 9: 91,364,732 S96P probably damaging Het
Zw10 T A 9: 49,069,712 S471T probably benign Het
Other mutations in Fam234b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Fam234b APN 6 135225204 missense probably damaging 1.00
IGL01020:Fam234b APN 6 135211906 missense probably benign 0.13
IGL01731:Fam234b APN 6 135211905 missense possibly damaging 0.90
IGL01994:Fam234b APN 6 135225205 nonsense probably null
IGL02010:Fam234b APN 6 135209407 missense probably benign 0.17
IGL02071:Fam234b APN 6 135227151 critical splice acceptor site probably null
IGL02340:Fam234b APN 6 135231661 missense probably damaging 1.00
IGL02869:Fam234b APN 6 135225203 missense probably damaging 1.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0123:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0127:Fam234b UTSW 6 135218823 splice site probably benign
R0225:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0570:Fam234b UTSW 6 135209249 missense probably benign 0.00
R0705:Fam234b UTSW 6 135227215 missense probably benign 0.11
R1140:Fam234b UTSW 6 135225758 missense probably benign 0.00
R1446:Fam234b UTSW 6 135209330 splice site probably null
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R2044:Fam234b UTSW 6 135226914 missense probably benign 0.04
R2350:Fam234b UTSW 6 135231724 missense probably damaging 1.00
R3914:Fam234b UTSW 6 135225683 missense probably damaging 1.00
R4261:Fam234b UTSW 6 135209136 missense unknown
R5102:Fam234b UTSW 6 135209284 missense probably benign 0.03
R5133:Fam234b UTSW 6 135209195 missense probably benign 0.01
R5313:Fam234b UTSW 6 135209187 missense possibly damaging 0.56
R5375:Fam234b UTSW 6 135233357 missense probably damaging 1.00
R5418:Fam234b UTSW 6 135226968 missense probably benign 0.00
R5838:Fam234b UTSW 6 135225267 missense probably benign 0.00
R5953:Fam234b UTSW 6 135225707 missense possibly damaging 0.95
R6737:Fam234b UTSW 6 135228515 missense probably damaging 0.99
R7056:Fam234b UTSW 6 135228452 missense probably benign 0.32
R7418:Fam234b UTSW 6 135217011 missense probably benign 0.04
R7459:Fam234b UTSW 6 135211901 missense probably benign 0.04
R7599:Fam234b UTSW 6 135226876 missense probably damaging 1.00
R7602:Fam234b UTSW 6 135225243 missense possibly damaging 0.79
R7639:Fam234b UTSW 6 135225800 splice site probably null
R7748:Fam234b UTSW 6 135209351 missense probably damaging 1.00
R7773:Fam234b UTSW 6 135243914 missense probably benign 0.01
R8544:Fam234b UTSW 6 135233289 missense probably damaging 1.00
R9324:Fam234b UTSW 6 135225795 nonsense probably null
R9733:Fam234b UTSW 6 135217010 missense possibly damaging 0.50
Z1177:Fam234b UTSW 6 135198008 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-06-26