Incidental Mutation 'R7221:Cep126'
Institutional Source Beutler Lab
Gene Symbol Cep126
Ensembl Gene ENSMUSG00000040729
Gene Namecentrosomal protein 126
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7221 (G1)
Quality Score225.009
Status Validated
Chromosomal Location8076461-8134294 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 8100987 bp
Amino Acid Change Cysteine to Stop codon at position 515 (C515*)
Ref Sequence ENSEMBL: ENSMUSP00000042904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037397]
Predicted Effect probably null
Transcript: ENSMUST00000037397
AA Change: C515*
SMART Domains Protein: ENSMUSP00000042904
Gene: ENSMUSG00000040729
AA Change: C515*

low complexity region 6 36 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:K1377 100 1061 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,475,001 D232A possibly damaging Het
Abr A C 11: 76,423,161 M720R probably benign Het
Acad10 G A 5: 121,630,210 T761M probably damaging Het
Agxt G T 1: 93,137,901 G164V possibly damaging Het
Ankar C T 1: 72,650,231 G1247D probably damaging Het
Bptf A C 11: 107,054,832 L2527R probably damaging Het
Brinp2 T C 1: 158,266,547 H195R possibly damaging Het
C130079G13Rik A G 3: 59,928,933 probably benign Het
Cacna2d4 G T 6: 119,236,663 R14S probably benign Het
Chia1 A T 3: 106,131,920 N442I probably damaging Het
Clasp2 A G 9: 113,852,757 D327G probably damaging Het
Cnbd2 T C 2: 156,373,661 F519L probably benign Het
Cntrl T A 2: 35,151,857 F1214I possibly damaging Het
Cul9 A T 17: 46,528,565 M829K probably damaging Het
Cyp4b1 T C 4: 115,635,978 Q223R possibly damaging Het
Defb37 A T 8: 18,990,972 M1K probably null Het
Dnah7c A T 1: 46,455,777 Q55L possibly damaging Het
Eif2b4 A T 5: 31,187,787 D463E possibly damaging Het
Elovl1 C T 4: 118,431,614 H167Y probably damaging Het
Emb T A 13: 117,267,477 L255Q probably damaging Het
Eogt T C 6: 97,112,724 Y465C probably damaging Het
Erc2 A G 14: 27,653,158 H111R probably damaging Het
Fam234b T C 6: 135,228,531 F498S probably damaging Het
Fgfr3 GAGGCTGGCAGCGTGTACGCAGGC GAGGC 5: 33,732,748 probably null Het
Flrt3 T A 2: 140,661,170 E179D probably damaging Het
Fndc3a T C 14: 72,556,157 R993G probably benign Het
Gm11639 A G 11: 104,900,606 N2882S probably benign Het
Gm13762 A G 2: 88,973,153 V246A probably damaging Het
Gm14325 T C 2: 177,834,610 T14A probably damaging Het
Gm5464 T A 14: 66,869,232 V106D unknown Het
Gm7697 T G 8: 69,522,664 D50A probably benign Het
Gpatch11 T A 17: 78,842,117 I182N possibly damaging Het
Grm6 A G 11: 50,863,043 R725G probably damaging Het
Hap1 A T 11: 100,348,829 M588K probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ints8 A G 4: 11,225,613 M648T probably benign Het
Ipo11 A T 13: 106,892,557 L296Q probably damaging Het
Kirrel G A 3: 87,086,397 Q518* probably null Het
Krt18 G T 15: 102,029,532 D155Y possibly damaging Het
Lctl A T 9: 64,118,935 K91* probably null Het
Marf1 C A 16: 14,142,485 R565L probably damaging Het
Med13 A T 11: 86,288,095 D1458E probably benign Het
Mroh8 T A 2: 157,229,917 Y556F probably benign Het
Muc16 C T 9: 18,642,199 G4266D probably benign Het
Nsrp1 A T 11: 77,048,423 F182I probably damaging Het
Obox3 A T 7: 15,626,058 Y229N probably benign Het
Olfr1184 T A 2: 88,487,629 V299D probably damaging Het
Olfr124 A G 17: 37,805,561 K139E probably benign Het
Olfr1247 T C 2: 89,609,928 Y58C probably damaging Het
Olfr1359 T C 13: 21,703,102 S34P probably damaging Het
Olfr26 A G 9: 38,855,242 Y60C probably damaging Het
Olfr746 A T 14: 50,654,071 Y278F probably damaging Het
Pabpc2 T A 18: 39,773,910 V76D possibly damaging Het
Parp9 T C 16: 35,953,701 W348R probably benign Het
Pdp1 T C 4: 11,961,004 T455A probably damaging Het
Phactr2 A C 10: 13,247,039 D446E possibly damaging Het
Pi4kb T C 3: 94,994,189 L389P probably damaging Het
Pla2g4f C T 2: 120,300,995 R749H probably benign Het
Plec A G 15: 76,175,774 V3321A probably damaging Het
Plod2 T C 9: 92,584,527 V180A probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Rubcn T C 16: 32,866,923 probably null Het
Sacs T C 14: 61,208,806 V2767A probably damaging Het
Selenbp2 C G 3: 94,703,826 Y414* probably null Het
Slc45a4 A T 15: 73,586,410 M430K probably benign Het
Smg1 A G 7: 118,182,797 L1145P possibly damaging Het
Spns2 A G 11: 72,456,916 V316A probably benign Het
Srl T A 16: 4,482,947 E753D probably damaging Het
Thada T C 17: 84,464,366 T23A possibly damaging Het
Tmem231 T C 8: 111,933,676 T31A probably benign Het
Tpr C T 1: 150,446,178 T2321M possibly damaging Het
Ttn T A 2: 76,941,851 N2615I unknown Het
Vmn1r41 A G 6: 89,747,052 I192V probably benign Het
Vmn2r83 A T 10: 79,480,167 T466S probably benign Het
Vnn1 A G 10: 23,895,054 D60G probably benign Het
Wiz G A 17: 32,359,165 P449S probably benign Het
Zic1 A G 9: 91,364,732 S96P probably damaging Het
Zw10 T A 9: 49,069,712 S471T probably benign Het
Other mutations in Cep126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Cep126 APN 9 8103319 missense possibly damaging 0.57
IGL01967:Cep126 APN 9 8095208 splice site probably null
IGL02065:Cep126 APN 9 8099924 missense probably benign 0.09
IGL03215:Cep126 APN 9 8100530 nonsense probably null
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0184:Cep126 UTSW 9 8103395 missense probably benign 0.19
R0835:Cep126 UTSW 9 8130223 missense probably damaging 1.00
R0980:Cep126 UTSW 9 8100719 missense probably damaging 0.99
R1288:Cep126 UTSW 9 8112181 missense probably benign 0.01
R1341:Cep126 UTSW 9 8099776 missense possibly damaging 0.78
R1351:Cep126 UTSW 9 8100086 missense probably damaging 0.99
R1484:Cep126 UTSW 9 8100553 missense possibly damaging 0.81
R1707:Cep126 UTSW 9 8100382 missense probably benign 0.00
R1732:Cep126 UTSW 9 8099761 missense probably benign
R1903:Cep126 UTSW 9 8120747 missense possibly damaging 0.58
R1968:Cep126 UTSW 9 8100908 missense probably damaging 1.00
R2216:Cep126 UTSW 9 8120678 missense probably damaging 1.00
R2260:Cep126 UTSW 9 8101748 missense possibly damaging 0.50
R2444:Cep126 UTSW 9 8101306 missense probably damaging 1.00
R4208:Cep126 UTSW 9 8100821 missense probably damaging 1.00
R4499:Cep126 UTSW 9 8101588 missense possibly damaging 0.80
R4585:Cep126 UTSW 9 8103337 missense probably damaging 0.99
R5547:Cep126 UTSW 9 8100427 missense probably damaging 0.97
R5752:Cep126 UTSW 9 8120745 nonsense probably null
R5794:Cep126 UTSW 9 8103439 missense possibly damaging 0.64
R5932:Cep126 UTSW 9 8103508 missense probably damaging 1.00
R5956:Cep126 UTSW 9 8112119 missense probably benign 0.08
R6354:Cep126 UTSW 9 8099927 missense probably damaging 1.00
R6442:Cep126 UTSW 9 8100563 missense probably benign 0.14
R6964:Cep126 UTSW 9 8112100 missense probably null 0.99
R7134:Cep126 UTSW 9 8103382 missense probably damaging 1.00
R7161:Cep126 UTSW 9 8087399 missense probably benign 0.02
R7338:Cep126 UTSW 9 8099798 missense possibly damaging 0.50
R7345:Cep126 UTSW 9 8099816 missense probably damaging 1.00
R7473:Cep126 UTSW 9 8101778 missense probably damaging 1.00
R7860:Cep126 UTSW 9 8120748 missense probably damaging 1.00
R7974:Cep126 UTSW 9 8120763 missense probably benign 0.37
R8150:Cep126 UTSW 9 8101790 missense probably benign 0.04
R8204:Cep126 UTSW 9 8120780 missense probably damaging 1.00
X0060:Cep126 UTSW 9 8087255 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-06-26