Incidental Mutation 'R7221:Med13'
ID 561834
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 045293-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R7221 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86178921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1458 (D1458E)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably benign
Transcript: ENSMUST00000043624
AA Change: D1458E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: D1458E

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 A G 3: 59,836,354 (GRCm39) probably benign Het
Abr A C 11: 76,313,987 (GRCm39) M720R probably benign Het
Acad10 G A 5: 121,768,273 (GRCm39) T761M probably damaging Het
Agxt G T 1: 93,065,623 (GRCm39) G164V possibly damaging Het
Ankar C T 1: 72,689,390 (GRCm39) G1247D probably damaging Het
Bptf A C 11: 106,945,658 (GRCm39) L2527R probably damaging Het
Brinp2 T C 1: 158,094,117 (GRCm39) H195R possibly damaging Het
Cacna2d4 G T 6: 119,213,624 (GRCm39) R14S probably benign Het
Cep126 A T 9: 8,100,988 (GRCm39) C515* probably null Het
Chia1 A T 3: 106,039,236 (GRCm39) N442I probably damaging Het
Clasp2 A G 9: 113,681,825 (GRCm39) D327G probably damaging Het
Cnbd2 T C 2: 156,215,581 (GRCm39) F519L probably benign Het
Cntrl T A 2: 35,041,869 (GRCm39) F1214I possibly damaging Het
Cul9 A T 17: 46,839,491 (GRCm39) M829K probably damaging Het
Cyp4b1 T C 4: 115,493,175 (GRCm39) Q223R possibly damaging Het
Defb37 A T 8: 19,040,988 (GRCm39) M1K probably null Het
Dnah7c A T 1: 46,494,937 (GRCm39) Q55L possibly damaging Het
Efcab3 A G 11: 104,791,432 (GRCm39) N2882S probably benign Het
Eif2b4 A T 5: 31,345,131 (GRCm39) D463E possibly damaging Het
Elapor1 T G 3: 108,382,317 (GRCm39) D232A possibly damaging Het
Elovl1 C T 4: 118,288,811 (GRCm39) H167Y probably damaging Het
Emb T A 13: 117,404,013 (GRCm39) L255Q probably damaging Het
Eogt T C 6: 97,089,685 (GRCm39) Y465C probably damaging Het
Erc2 A G 14: 27,375,115 (GRCm39) H111R probably damaging Het
Fam234b T C 6: 135,205,529 (GRCm39) F498S probably damaging Het
Fgfr3 GAGGCTGGCAGCGTGTACGCAGGC GAGGC 5: 33,890,092 (GRCm39) probably null Het
Flrt3 T A 2: 140,503,090 (GRCm39) E179D probably damaging Het
Fndc3a T C 14: 72,793,597 (GRCm39) R993G probably benign Het
Gm14325 T C 2: 177,476,403 (GRCm39) T14A probably damaging Het
Gm5464 T A 14: 67,106,681 (GRCm39) V106D unknown Het
Gpatch11 T A 17: 79,149,546 (GRCm39) I182N possibly damaging Het
Grm6 A G 11: 50,753,870 (GRCm39) R725G probably damaging Het
Hap1 A T 11: 100,239,655 (GRCm39) M588K probably benign Het
Icam2 A G 11: 106,273,268 (GRCm39) F15L probably benign Het
Ints8 A G 4: 11,225,613 (GRCm39) M648T probably benign Het
Ipo11 A T 13: 107,029,065 (GRCm39) L296Q probably damaging Het
Kirrel1 G A 3: 86,993,704 (GRCm39) Q518* probably null Het
Krt18 G T 15: 101,937,967 (GRCm39) D155Y possibly damaging Het
Lctl A T 9: 64,026,217 (GRCm39) K91* probably null Het
Marf1 C A 16: 13,960,349 (GRCm39) R565L probably damaging Het
Mroh8 T A 2: 157,071,837 (GRCm39) Y556F probably benign Het
Muc16 C T 9: 18,553,495 (GRCm39) G4266D probably benign Het
Nsrp1 A T 11: 76,939,249 (GRCm39) F182I probably damaging Het
Obox3 A T 7: 15,359,983 (GRCm39) Y229N probably benign Het
Or11h7 A T 14: 50,891,528 (GRCm39) Y278F probably damaging Het
Or2b2 T C 13: 21,887,272 (GRCm39) S34P probably damaging Het
Or2b4 A G 17: 38,116,452 (GRCm39) K139E probably benign Het
Or4a74 T C 2: 89,440,272 (GRCm39) Y58C probably damaging Het
Or4c108 A G 2: 88,803,497 (GRCm39) V246A probably damaging Het
Or4p22 T A 2: 88,317,973 (GRCm39) V299D probably damaging Het
Or8d1 A G 9: 38,766,538 (GRCm39) Y60C probably damaging Het
Pabpc2 T A 18: 39,906,963 (GRCm39) V76D possibly damaging Het
Parp9 T C 16: 35,774,071 (GRCm39) W348R probably benign Het
Pdp1 T C 4: 11,961,004 (GRCm39) T455A probably damaging Het
Phactr2 A C 10: 13,122,783 (GRCm39) D446E possibly damaging Het
Pi4kb T C 3: 94,901,500 (GRCm39) L389P probably damaging Het
Pla2g4f C T 2: 120,131,476 (GRCm39) R749H probably benign Het
Plec A G 15: 76,059,974 (GRCm39) V3321A probably damaging Het
Plod2 T C 9: 92,466,580 (GRCm39) V180A probably damaging Het
Plppr5 A G 3: 117,414,618 (GRCm39) I80V probably damaging Het
Potefam3d T G 8: 69,975,316 (GRCm39) D50A probably benign Het
Rubcn T C 16: 32,687,293 (GRCm39) probably null Het
Sacs T C 14: 61,446,255 (GRCm39) V2767A probably damaging Het
Selenbp2 C G 3: 94,611,133 (GRCm39) Y414* probably null Het
Slc45a4 A T 15: 73,458,259 (GRCm39) M430K probably benign Het
Smg1 A G 7: 117,782,020 (GRCm39) L1145P possibly damaging Het
Spns2 A G 11: 72,347,742 (GRCm39) V316A probably benign Het
Srl T A 16: 4,300,811 (GRCm39) E753D probably damaging Het
Thada T C 17: 84,771,794 (GRCm39) T23A possibly damaging Het
Tmem231 T C 8: 112,660,308 (GRCm39) T31A probably benign Het
Tpr C T 1: 150,321,929 (GRCm39) T2321M possibly damaging Het
Ttn T A 2: 76,772,195 (GRCm39) N2615I unknown Het
Vmn1r41 A G 6: 89,724,034 (GRCm39) I192V probably benign Het
Vmn2r83 A T 10: 79,316,001 (GRCm39) T466S probably benign Het
Vnn1 A G 10: 23,770,952 (GRCm39) D60G probably benign Het
Wiz G A 17: 32,578,139 (GRCm39) P449S probably benign Het
Zic1 A G 9: 91,246,785 (GRCm39) S96P probably damaging Het
Zw10 T A 9: 48,981,012 (GRCm39) S471T probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0116:Med13 UTSW 11 86,210,723 (GRCm39) missense probably damaging 0.99
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0497:Med13 UTSW 11 86,167,809 (GRCm39) splice site probably benign
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0709:Med13 UTSW 11 86,210,422 (GRCm39) missense possibly damaging 0.95
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4598:Med13 UTSW 11 86,169,392 (GRCm39) missense probably damaging 0.97
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R4974:Med13 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R5056:Med13 UTSW 11 86,219,391 (GRCm39) missense probably benign 0.00
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5206:Med13 UTSW 11 86,210,705 (GRCm39) missense probably damaging 1.00
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R8671:Med13 UTSW 11 86,161,923 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCAGCAGAGAATATTTTGGAACC -3'
(R):5'- GGCCAACACAGACCTATTTCTC -3'

Sequencing Primer
(F):5'- CAGAGCTAGCAGACTTTCTATGGAC -3'
(R):5'- ACAGACCTATTTCTCGATTGTTGACG -3'
Posted On 2019-06-26