Incidental Mutation 'R7221:Hap1'
ID561835
Institutional Source Beutler Lab
Gene Symbol Hap1
Ensembl Gene ENSMUSG00000006930
Gene Namehuntingtin-associated protein 1
SynonymsHAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R7221 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100347327-100356128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100348829 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 588 (M588K)
Ref Sequence ENSEMBL: ENSMUSP00000133356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103124] [ENSMUST00000138603] [ENSMUST00000146878] [ENSMUST00000174635]
Predicted Effect probably benign
Transcript: ENSMUST00000103124
SMART Domains Protein: ENSMUSP00000099413
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 79 403 5e-111 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138603
AA Change: M588K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133356
Gene: ENSMUSG00000006930
AA Change: M588K

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 80 402 1.4e-109 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146878
SMART Domains Protein: ENSMUSP00000134625
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
Pfam:HAP1_N 1 181 2.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173630
SMART Domains Protein: ENSMUSP00000134050
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
Pfam:HAP1_N 1 177 1e-46 PFAM
low complexity region 250 268 N/A INTRINSIC
low complexity region 275 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174635
SMART Domains Protein: ENSMUSP00000133831
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
low complexity region 119 137 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: The protein encoded by this gene was first identified as a neuronal protein that binds the HD protein huntingtin. The protein also interacts with kinesin light chain, 14-3-3 proteins, and Abelson helper integration site 1 protein. The protein is involved in intracellular trafficking of vesicles and organelles, and lack of the protein results in neuronal death resembling the hypothalamic degeneration that occurs in Huntington's disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal feeding and/or suckling behavior, absent gastric milk in neonates, slow postnatal weight gain, and postnatal death. Degeneration in hypothalamic regions that control feeding behavior has been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,475,001 D232A possibly damaging Het
Abr A C 11: 76,423,161 M720R probably benign Het
Acad10 G A 5: 121,630,210 T761M probably damaging Het
Agxt G T 1: 93,137,901 G164V possibly damaging Het
Ankar C T 1: 72,650,231 G1247D probably damaging Het
Bptf A C 11: 107,054,832 L2527R probably damaging Het
Brinp2 T C 1: 158,266,547 H195R possibly damaging Het
C130079G13Rik A G 3: 59,928,933 probably benign Het
Cacna2d4 G T 6: 119,236,663 R14S probably benign Het
Cep126 A T 9: 8,100,987 C515* probably null Het
Chia1 A T 3: 106,131,920 N442I probably damaging Het
Clasp2 A G 9: 113,852,757 D327G probably damaging Het
Cnbd2 T C 2: 156,373,661 F519L probably benign Het
Cntrl T A 2: 35,151,857 F1214I possibly damaging Het
Cul9 A T 17: 46,528,565 M829K probably damaging Het
Cyp4b1 T C 4: 115,635,978 Q223R possibly damaging Het
Defb37 A T 8: 18,990,972 M1K probably null Het
Dnah7c A T 1: 46,455,777 Q55L possibly damaging Het
Eif2b4 A T 5: 31,187,787 D463E possibly damaging Het
Elovl1 C T 4: 118,431,614 H167Y probably damaging Het
Emb T A 13: 117,267,477 L255Q probably damaging Het
Eogt T C 6: 97,112,724 Y465C probably damaging Het
Erc2 A G 14: 27,653,158 H111R probably damaging Het
Fam234b T C 6: 135,228,531 F498S probably damaging Het
Fgfr3 GAGGCTGGCAGCGTGTACGCAGGC GAGGC 5: 33,732,748 probably null Het
Flrt3 T A 2: 140,661,170 E179D probably damaging Het
Fndc3a T C 14: 72,556,157 R993G probably benign Het
Gm11639 A G 11: 104,900,606 N2882S probably benign Het
Gm13762 A G 2: 88,973,153 V246A probably damaging Het
Gm14325 T C 2: 177,834,610 T14A probably damaging Het
Gm5464 T A 14: 66,869,232 V106D unknown Het
Gm7697 T G 8: 69,522,664 D50A probably benign Het
Gpatch11 T A 17: 78,842,117 I182N possibly damaging Het
Grm6 A G 11: 50,863,043 R725G probably damaging Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ints8 A G 4: 11,225,613 M648T probably benign Het
Ipo11 A T 13: 106,892,557 L296Q probably damaging Het
Kirrel G A 3: 87,086,397 Q518* probably null Het
Krt18 G T 15: 102,029,532 D155Y possibly damaging Het
Lctl A T 9: 64,118,935 K91* probably null Het
Marf1 C A 16: 14,142,485 R565L probably damaging Het
Med13 A T 11: 86,288,095 D1458E probably benign Het
Mroh8 T A 2: 157,229,917 Y556F probably benign Het
Muc16 C T 9: 18,642,199 G4266D probably benign Het
Nsrp1 A T 11: 77,048,423 F182I probably damaging Het
Obox3 A T 7: 15,626,058 Y229N probably benign Het
Olfr1184 T A 2: 88,487,629 V299D probably damaging Het
Olfr124 A G 17: 37,805,561 K139E probably benign Het
Olfr1247 T C 2: 89,609,928 Y58C probably damaging Het
Olfr1359 T C 13: 21,703,102 S34P probably damaging Het
Olfr26 A G 9: 38,855,242 Y60C probably damaging Het
Olfr746 A T 14: 50,654,071 Y278F probably damaging Het
Pabpc2 T A 18: 39,773,910 V76D possibly damaging Het
Parp9 T C 16: 35,953,701 W348R probably benign Het
Pdp1 T C 4: 11,961,004 T455A probably damaging Het
Phactr2 A C 10: 13,247,039 D446E possibly damaging Het
Pi4kb T C 3: 94,994,189 L389P probably damaging Het
Pla2g4f C T 2: 120,300,995 R749H probably benign Het
Plec A G 15: 76,175,774 V3321A probably damaging Het
Plod2 T C 9: 92,584,527 V180A probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Rubcn T C 16: 32,866,923 probably null Het
Sacs T C 14: 61,208,806 V2767A probably damaging Het
Selenbp2 C G 3: 94,703,826 Y414* probably null Het
Slc45a4 A T 15: 73,586,410 M430K probably benign Het
Smg1 A G 7: 118,182,797 L1145P possibly damaging Het
Spns2 A G 11: 72,456,916 V316A probably benign Het
Srl T A 16: 4,482,947 E753D probably damaging Het
Thada T C 17: 84,464,366 T23A possibly damaging Het
Tmem231 T C 8: 111,933,676 T31A probably benign Het
Tpr C T 1: 150,446,178 T2321M possibly damaging Het
Ttn T A 2: 76,941,851 N2615I unknown Het
Vmn1r41 A G 6: 89,747,052 I192V probably benign Het
Vmn2r83 A T 10: 79,480,167 T466S probably benign Het
Vnn1 A G 10: 23,895,054 D60G probably benign Het
Wiz G A 17: 32,359,165 P449S probably benign Het
Zic1 A G 9: 91,364,732 S96P probably damaging Het
Zw10 T A 9: 49,069,712 S471T probably benign Het
Other mutations in Hap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Hap1 APN 11 100349548 missense probably benign 0.00
IGL01320:Hap1 APN 11 100349380 missense probably damaging 0.96
IGL01790:Hap1 APN 11 100351906 unclassified probably null
IGL01949:Hap1 APN 11 100348762 missense probably damaging 0.96
IGL02325:Hap1 APN 11 100354364 critical splice acceptor site probably null
IGL03399:Hap1 APN 11 100354267 missense possibly damaging 0.90
R0346:Hap1 UTSW 11 100356029 missense probably benign
R0463:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R0608:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R1112:Hap1 UTSW 11 100354317 missense probably damaging 1.00
R1682:Hap1 UTSW 11 100349476 missense possibly damaging 0.46
R1952:Hap1 UTSW 11 100352279 missense probably damaging 1.00
R2079:Hap1 UTSW 11 100353746 missense probably damaging 1.00
R2088:Hap1 UTSW 11 100356002 missense probably benign
R2112:Hap1 UTSW 11 100353999 missense probably benign 0.28
R2211:Hap1 UTSW 11 100354724 missense probably benign 0.21
R2354:Hap1 UTSW 11 100354715 missense probably damaging 1.00
R3829:Hap1 UTSW 11 100356021 missense probably damaging 0.99
R4259:Hap1 UTSW 11 100351842 critical splice donor site probably null
R4429:Hap1 UTSW 11 100354272 missense probably benign 0.00
R4585:Hap1 UTSW 11 100354724 missense probably benign 0.21
R4586:Hap1 UTSW 11 100354724 missense probably benign 0.21
R5085:Hap1 UTSW 11 100355711 missense probably damaging 1.00
R5133:Hap1 UTSW 11 100351531 missense probably benign 0.00
R5762:Hap1 UTSW 11 100355774 missense probably damaging 1.00
R6118:Hap1 UTSW 11 100355794 missense probably benign 0.24
R6148:Hap1 UTSW 11 100349392 missense probably damaging 1.00
R7683:Hap1 UTSW 11 100351548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGATGGGCTGAGGGAAC -3'
(R):5'- TGCTTACAAGTCCAGCTGTCC -3'

Sequencing Primer
(F):5'- ACACTCACCCGGGGGAATG -3'
(R):5'- AAGTCCAGCTGTCCGTCCAC -3'
Posted On2019-06-26