Incidental Mutation 'R0575:Ankrd44'
ID56184
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R0575 (G1)
Quality Score101
Status Validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54762310 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 286 (A286V)
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000177679] [ENSMUST00000178226] [ENSMUST00000179030]
Predicted Effect probably damaging
Transcript: ENSMUST00000044359
AA Change: A286V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: A286V

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177679
SMART Domains Protein: ENSMUSP00000137216
Gene: ENSMUSG00000052331

DomainStartEndE-ValueType
ANK 15 44 3.23e-4 SMART
ANK 48 77 1.12e-3 SMART
ANK 81 110 1.65e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177919
Predicted Effect possibly damaging
Transcript: ENSMUST00000178226
AA Change: A83V

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136802
Gene: ENSMUSG00000052331
AA Change: A83V

DomainStartEndE-ValueType
ANK 2 31 1.1e-6 SMART
ANK 35 64 9.7e-8 SMART
ANK 68 98 1.11e-2 SMART
ANK 102 131 9.35e-1 SMART
ANK 135 164 2.02e-5 SMART
ANK 168 197 5.98e1 SMART
ANK 219 248 7.13e-6 SMART
ANK 252 281 1.18e-6 SMART
ANK 285 342 1.17e2 SMART
ANK 346 376 3.31e-1 SMART
ANK 381 410 3.91e-3 SMART
ANK 414 443 1.43e-5 SMART
ANK 448 477 2.73e-2 SMART
ANK 484 513 5.41e-6 SMART
ANK 517 546 5.53e-3 SMART
ANK 550 582 1.52e0 SMART
ANK 586 616 9.27e-5 SMART
ANK 618 648 1.52e0 SMART
ANK 653 682 6.02e-4 SMART
ANK 686 716 3.08e-1 SMART
ANK 720 752 3.36e-2 SMART
ANK 756 785 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178935
Predicted Effect probably damaging
Transcript: ENSMUST00000179030
AA Change: A286V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: A286V

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188243
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7219:Ankrd44 UTSW 1 54766910 missense probably damaging 1.00
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
R7414:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R7490:Ankrd44 UTSW 1 54648300 missense probably benign 0.03
R7501:Ankrd44 UTSW 1 54649363 missense
R7515:Ankrd44 UTSW 1 54766355 missense probably damaging 1.00
R7527:Ankrd44 UTSW 1 54648324 missense probably benign 0.08
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCGACCCAACTATTTCCACAG -3'
(R):5'- ACTCGCTCTCAGCTCTCAGGATAAC -3'

Sequencing Primer
(F):5'- ATCTCAATCCAGGGCCAGG -3'
(R):5'- AGCTCTCAGGATAACCTGCTG -3'
Posted On2013-07-11