Incidental Mutation 'R7222:P2ry14'
ID561864
Institutional Source Beutler Lab
Gene Symbol P2ry14
Ensembl Gene ENSMUSG00000036381
Gene Namepurinergic receptor P2Y, G-protein coupled, 14
SynonymsGpr105, P2Y14, A330108O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location59113855-59153618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59115382 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 219 (K219R)
Ref Sequence ENSEMBL: ENSMUSP00000066669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000065220] [ENSMUST00000091112] [ENSMUST00000164225] [ENSMUST00000196081] [ENSMUST00000197220] [ENSMUST00000197841] [ENSMUST00000198838] [ENSMUST00000199659] [ENSMUST00000200358] [ENSMUST00000200673]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065220
AA Change: K219R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066669
Gene: ENSMUSG00000036381
AA Change: K219R

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091112
AA Change: K219R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088642
Gene: ENSMUSG00000036381
AA Change: K219R

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 4.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196081
AA Change: K219R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142601
Gene: ENSMUSG00000036381
AA Change: K219R

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197220
AA Change: K219R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143070
Gene: ENSMUSG00000036381
AA Change: K219R

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197841
AA Change: K228R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142934
Gene: ENSMUSG00000036381
AA Change: K228R

DomainStartEndE-ValueType
Pfam:7tm_1 49 304 1.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198838
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200358
SMART Domains Protein: ENSMUSP00000142641
Gene: ENSMUSG00000036381

DomainStartEndE-ValueType
Pfam:7tm_1 39 110 8.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200673
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors, which contains several receptor subtypes with different pharmacological selectivity for various adenosine and uridine nucleotides. This receptor is a P2Y purinergic receptor for UDP-glucose and other UDP-sugars coupled to G-proteins. It has been implicated in extending the known immune system functions of P2Y receptors by participating in the regulation of the stem cell compartment, and it may also play a role in neuroimmune function. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to exhibit increased glucose mediated forestomach muscle tension. Mice homozygous for a different null allele show decreased gastrointestinal emptying, impaired glucose tolerance, decreased glucose-stimulated insulin release, and reduced airway responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in P2ry14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:P2ry14 APN 3 59115335 missense probably damaging 1.00
R0091:P2ry14 UTSW 3 59115893 missense probably benign 0.01
R0511:P2ry14 UTSW 3 59116028 missense possibly damaging 0.89
R0518:P2ry14 UTSW 3 59115204 missense probably damaging 1.00
R0638:P2ry14 UTSW 3 59115448 missense probably benign 0.00
R1167:P2ry14 UTSW 3 59115131 missense probably damaging 0.99
R1540:P2ry14 UTSW 3 59115265 missense probably benign 0.08
R1795:P2ry14 UTSW 3 59115853 missense probably damaging 1.00
R2025:P2ry14 UTSW 3 59115445 missense probably damaging 1.00
R2096:P2ry14 UTSW 3 59115317 missense probably damaging 1.00
R2265:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R2266:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R2267:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R4664:P2ry14 UTSW 3 59115142 missense probably damaging 1.00
R5294:P2ry14 UTSW 3 59115568 missense possibly damaging 0.93
R5721:P2ry14 UTSW 3 59115031 unclassified probably null
R5969:P2ry14 UTSW 3 59115158 missense probably damaging 1.00
R6077:P2ry14 UTSW 3 59115377 missense probably damaging 0.99
R6619:P2ry14 UTSW 3 59115733 missense probably damaging 1.00
R7452:P2ry14 UTSW 3 59116045 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTCTTTCGCATAGAGCAGGGTC -3'
(R):5'- GTGGATGCTCATGCTTCTCC -3'

Sequencing Primer
(F):5'- ATAGAGCAGGGTCTCCTTCGTC -3'
(R):5'- GCTGTCCCAAACATCATCCTG -3'
Posted On2019-06-26