Incidental Mutation 'R7222:Flg'
ID561865
Institutional Source Beutler Lab
Gene Symbol Flg
Ensembl Gene ENSMUSG00000102439
Gene Namefilaggrin
Synonymsft, fillagrin, profilaggrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R7222 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93273523-93293686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93288314 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 74 (S74T)
Ref Sequence ENSEMBL: ENSMUSP00000141513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050758] [ENSMUST00000178695] [ENSMUST00000178752] [ENSMUST00000179250] [ENSMUST00000179477] [ENSMUST00000180293]
Predicted Effect probably benign
Transcript: ENSMUST00000050758
SMART Domains Protein: ENSMUSP00000142294
Gene: ENSMUSG00000102439

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 35 98 N/A INTRINSIC
low complexity region 154 207 N/A INTRINSIC
low complexity region 235 276 N/A INTRINSIC
low complexity region 285 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178695
SMART Domains Protein: ENSMUSP00000141392
Gene: ENSMUSG00000102439

DomainStartEndE-ValueType
low complexity region 15 66 N/A INTRINSIC
low complexity region 94 109 N/A INTRINSIC
low complexity region 115 135 N/A INTRINSIC
low complexity region 144 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178752
SMART Domains Protein: ENSMUSP00000141273
Gene: ENSMUSG00000102439

DomainStartEndE-ValueType
low complexity region 10 59 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 108 128 N/A INTRINSIC
low complexity region 137 200 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000179250
AA Change: S74T
SMART Domains Protein: ENSMUSP00000141513
Gene: ENSMUSG00000102439
AA Change: S74T

DomainStartEndE-ValueType
low complexity region 9 62 N/A INTRINSIC
low complexity region 90 105 N/A INTRINSIC
low complexity region 109 138 N/A INTRINSIC
low complexity region 140 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179477
SMART Domains Protein: ENSMUSP00000141987
Gene: ENSMUSG00000102439

DomainStartEndE-ValueType
low complexity region 10 49 N/A INTRINSIC
internal_repeat_1 50 85 7.34e-5 PROSPERO
low complexity region 91 106 N/A INTRINSIC
low complexity region 112 132 N/A INTRINSIC
low complexity region 141 204 N/A INTRINSIC
internal_repeat_1 222 255 7.34e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000180293
SMART Domains Protein: ENSMUSP00000141844
Gene: ENSMUSG00000102439

DomainStartEndE-ValueType
low complexity region 10 63 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
low complexity region 112 132 N/A INTRINSIC
low complexity region 141 204 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mutations in this gene produce abnormalities in the skin of the ear, tail and dorsal trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Flg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Flg APN 3 93279599 missense probably benign 0.41
FR4342:Flg UTSW 3 93290513 unclassified probably benign
R0046:Flg UTSW 3 93277721 splice site probably benign
R0046:Flg UTSW 3 93277721 splice site probably benign
R0538:Flg UTSW 3 93279460 missense probably damaging 1.00
R1751:Flg UTSW 3 93279913 missense possibly damaging 0.91
R1767:Flg UTSW 3 93279913 missense possibly damaging 0.91
R2024:Flg UTSW 3 93279415 missense probably damaging 0.99
R2213:Flg UTSW 3 93293028 unclassified probably benign
R2311:Flg UTSW 3 93292953 unclassified probably benign
R2513:Flg UTSW 3 93279786 missense possibly damaging 0.83
R3892:Flg UTSW 3 93279526 missense probably benign 0.01
R3911:Flg UTSW 3 93280000 missense probably benign 0.01
R4207:Flg UTSW 3 93279862 missense probably benign 0.10
R4385:Flg UTSW 3 93293009 unclassified probably benign
R4939:Flg UTSW 3 93279847 missense probably benign 0.00
R5084:Flg UTSW 3 93277615 missense probably damaging 0.99
R5540:Flg UTSW 3 93277616 missense probably damaging 1.00
R5925:Flg UTSW 3 93279399 missense probably damaging 0.98
R5972:Flg UTSW 3 93279542 missense probably benign 0.00
R6130:Flg UTSW 3 93292716 unclassified probably benign
R6144:Flg UTSW 3 93283208 unclassified probably benign
R6184:Flg UTSW 3 93280050 missense probably benign 0.04
R6230:Flg UTSW 3 93279475 missense probably damaging 1.00
R6268:Flg UTSW 3 93288175 unclassified probably benign
R6360:Flg UTSW 3 93290601 unclassified probably benign
R6400:Flg UTSW 3 93279921 missense probably benign 0.41
R6464:Flg UTSW 3 93281381 unclassified probably benign
R6586:Flg UTSW 3 93292983 unclassified probably benign
R6685:Flg UTSW 3 93279409 missense possibly damaging 0.53
R6769:Flg UTSW 3 93288323 unclassified probably benign
R6771:Flg UTSW 3 93288323 unclassified probably benign
R6948:Flg UTSW 3 93288168 unclassified probably benign
R7102:Flg UTSW 3 93293028 missense unknown
R7186:Flg UTSW 3 93279945 nonsense probably null
R7248:Flg UTSW 3 93281734 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GGCTCCGGATACTACTATGAGC -3'
(R):5'- CTCCAGAATGGACATGGCTG -3'

Sequencing Primer
(F):5'- TCCGGATACTACTATGAGCAAGAAC -3'
(R):5'- ACATGGCTGTCACTGGACTG -3'
Posted On2019-06-26