Incidental Mutation 'R0575:Dcun1d1'
ID56187
Institutional Source Beutler Lab
Gene Symbol Dcun1d1
Ensembl Gene ENSMUSG00000027708
Gene NameDCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
SynonymsSCCRO, Tes3, Rp42, pTes3
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R0575 (G1)
Quality Score159
Status Validated
Chromosome3
Chromosomal Location35892105-35937445 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 35897785 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108182] [ENSMUST00000148465] [ENSMUST00000178098] [ENSMUST00000197489] [ENSMUST00000198389] [ENSMUST00000200661]
Predicted Effect probably benign
Transcript: ENSMUST00000108182
SMART Domains Protein: ENSMUSP00000103817
Gene: ENSMUSG00000027708

DomainStartEndE-ValueType
Pfam:UBA_4 9 50 1.6e-12 PFAM
Pfam:Cullin_binding 136 247 2.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148465
SMART Domains Protein: ENSMUSP00000115420
Gene: ENSMUSG00000027708

DomainStartEndE-ValueType
Pfam:UBA_4 1 35 2.5e-8 PFAM
Pfam:Cullin_binding 119 214 9.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178098
SMART Domains Protein: ENSMUSP00000137324
Gene: ENSMUSG00000027708

DomainStartEndE-ValueType
Pfam:UBA_4 1 35 3e-8 PFAM
Pfam:Cullin_binding 119 233 6.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196261
Predicted Effect probably benign
Transcript: ENSMUST00000197489
SMART Domains Protein: ENSMUSP00000142690
Gene: ENSMUSG00000027708

DomainStartEndE-ValueType
Pfam:UBA_4 9 50 7.5e-11 PFAM
PDB:3TDZ|B 62 89 9e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000197546
Predicted Effect probably benign
Transcript: ENSMUST00000198389
SMART Domains Protein: ENSMUSP00000143243
Gene: ENSMUSG00000027708

DomainStartEndE-ValueType
Pfam:UBA_4 1 35 3e-8 PFAM
Pfam:Cullin_binding 119 233 6.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200661
SMART Domains Protein: ENSMUSP00000143716
Gene: ENSMUSG00000027708

DomainStartEndE-ValueType
Pfam:UBA_4 1 35 5e-9 PFAM
Pfam:Cullin_binding 121 220 9.9e-31 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Dcun1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dcun1d1 APN 3 35916306 missense possibly damaging 0.80
IGL00927:Dcun1d1 APN 3 35920965 splice site probably benign
IGL03092:Dcun1d1 APN 3 35920992 missense possibly damaging 0.88
IGL03214:Dcun1d1 APN 3 35919071 missense probably damaging 1.00
deacon UTSW 3 35897785 splice site probably benign
Preacher UTSW 3 35897791 critical splice donor site probably null
LCD18:Dcun1d1 UTSW 3 35938005 unclassified probably benign
R1006:Dcun1d1 UTSW 3 35897781 splice site probably benign
R1820:Dcun1d1 UTSW 3 35919004 nonsense probably null
R4714:Dcun1d1 UTSW 3 35895670 missense probably damaging 1.00
R5849:Dcun1d1 UTSW 3 35916184 intron probably benign
R6681:Dcun1d1 UTSW 3 35895670 missense probably damaging 1.00
R7312:Dcun1d1 UTSW 3 35897791 critical splice donor site probably null
X0018:Dcun1d1 UTSW 3 35921144 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- GTTGGGAAAAGTTAGTCCAGCATTTGC -3'
(R):5'- ATCCGCATCAGAACACCCTGTGAG -3'

Sequencing Primer
(F):5'- GACATGCTGAAATTAATGATGCCTTG -3'
(R):5'- GAGGTAAGCCAGACTGTTCTTCC -3'
Posted On2013-07-11