Incidental Mutation 'R0575:Lgi4'
ID56190
Institutional Source Beutler Lab
Gene Symbol Lgi4
Ensembl Gene ENSMUSG00000036560
Gene Nameleucine-rich repeat LGI family, member 4
Synonymsclp
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0575 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31059342-31070935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31060093 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 25 (G25R)
Ref Sequence ENSEMBL: ENSMUSP00000041579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039775] [ENSMUST00000039909] [ENSMUST00000164725] [ENSMUST00000169785] [ENSMUST00000205439] [ENSMUST00000205807] [ENSMUST00000206305] [ENSMUST00000206328] [ENSMUST00000206474]
Predicted Effect probably benign
Transcript: ENSMUST00000039775
AA Change: G25R

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041579
Gene: ENSMUSG00000036560
AA Change: G25R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
LRR 75 98 7.17e1 SMART
LRR 99 122 2.76e1 SMART
LRR_TYP 123 146 2.43e-4 SMART
LRRCT 158 207 3.97e-5 SMART
Pfam:EPTP 214 251 1.1e-7 PFAM
Pfam:EPTP 396 438 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039909
SMART Domains Protein: ENSMUSP00000048460
Gene: ENSMUSG00000036570

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 23 72 1.1e-31 PFAM
low complexity region 81 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164725
Predicted Effect probably benign
Transcript: ENSMUST00000169785
Predicted Effect probably benign
Transcript: ENSMUST00000172001
SMART Domains Protein: ENSMUSP00000125865
Gene: ENSMUSG00000036560

DomainStartEndE-ValueType
LRRCT 9 58 3.97e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205392
Predicted Effect probably benign
Transcript: ENSMUST00000205439
Predicted Effect probably benign
Transcript: ENSMUST00000205807
Predicted Effect probably benign
Transcript: ENSMUST00000206305
Predicted Effect probably benign
Transcript: ENSMUST00000206328
Predicted Effect probably benign
Transcript: ENSMUST00000206474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206522
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Homozygous mutant animals have an abnormal posture where the forelimbs are flexed and rotated inwards. The peripheral nervous system is delayed in myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Lgi4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lgi4 APN 7 31069043 missense probably benign 0.01
IGL01624:Lgi4 APN 7 31067688 missense probably damaging 1.00
IGL02251:Lgi4 APN 7 31067263 splice site probably null
IGL02755:Lgi4 APN 7 31063105 missense probably damaging 1.00
IGL03153:Lgi4 APN 7 31060558 missense probably damaging 1.00
IGL03392:Lgi4 APN 7 31063180 splice site probably null
R0060:Lgi4 UTSW 7 31063571 missense probably damaging 0.97
R2139:Lgi4 UTSW 7 31063123 missense probably damaging 1.00
R2276:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2277:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2278:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2939:Lgi4 UTSW 7 31067828 nonsense probably null
R3039:Lgi4 UTSW 7 31060067 missense probably benign
R3922:Lgi4 UTSW 7 31067448 missense probably benign
R4650:Lgi4 UTSW 7 31069129 missense probably benign 0.38
R5184:Lgi4 UTSW 7 31070757 unclassified probably benign
R5583:Lgi4 UTSW 7 31061137 missense possibly damaging 0.92
R5837:Lgi4 UTSW 7 31070783 unclassified probably benign
R5917:Lgi4 UTSW 7 31060178 missense possibly damaging 0.76
R6198:Lgi4 UTSW 7 31069122 unclassified probably null
R6454:Lgi4 UTSW 7 31060132 missense probably benign
R6845:Lgi4 UTSW 7 31061085 missense probably damaging 0.99
R6897:Lgi4 UTSW 7 31068890 missense probably benign 0.00
R7232:Lgi4 UTSW 7 31067351 missense possibly damaging 0.67
R7354:Lgi4 UTSW 7 31060622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAAGATCGAGAGGCATCCCAC -3'
(R):5'- TCTTTAAGAAGCTGCCAGCCTTCAG -3'

Sequencing Primer
(F):5'- CATCCCACGGAGATGTAGTG -3'
(R):5'- ATTCTGAGAGACCTTGGCAC -3'
Posted On2013-07-11