Incidental Mutation 'R7222:Lztr1'
ID561901
Institutional Source Beutler Lab
Gene Symbol Lztr1
Ensembl Gene ENSMUSG00000022761
Gene Nameleucine-zipper-like transcriptional regulator, 1
Synonyms1200003E21Rik, TCFL2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17508688-17526333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17524132 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 657 (E657G)
Ref Sequence ENSEMBL: ENSMUSP00000023444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023444] [ENSMUST00000100125] [ENSMUST00000231288] [ENSMUST00000231292] [ENSMUST00000231307] [ENSMUST00000231424] [ENSMUST00000231548] [ENSMUST00000231994] [ENSMUST00000232041] [ENSMUST00000232114] [ENSMUST00000232372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023444
AA Change: E657G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023444
Gene: ENSMUSG00000022761
AA Change: E657G

DomainStartEndE-ValueType
Pfam:Kelch_6 64 103 1.1e-7 PFAM
Pfam:Kelch_1 64 105 1.7e-7 PFAM
Pfam:Kelch_4 64 113 4.7e-10 PFAM
Pfam:Kelch_3 74 123 3.1e-10 PFAM
Pfam:Kelch_5 111 152 7.2e-9 PFAM
Pfam:Kelch_1 114 161 2.8e-7 PFAM
Pfam:Kelch_2 114 163 1e-7 PFAM
Pfam:Kelch_4 114 170 1.9e-6 PFAM
Pfam:Kelch_3 124 180 9.1e-9 PFAM
Pfam:Kelch_4 171 224 6.1e-6 PFAM
Pfam:Kelch_3 181 232 6e-7 PFAM
Pfam:Kelch_1 224 267 1e-6 PFAM
Pfam:Kelch_4 225 278 6.2e-6 PFAM
Pfam:Kelch_3 234 289 2.2e-8 PFAM
Pfam:Kelch_1 280 325 7.7e-10 PFAM
Pfam:Kelch_2 280 325 4.3e-7 PFAM
Pfam:Kelch_6 280 325 9.6e-9 PFAM
Pfam:Kelch_4 280 329 2.5e-8 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 765 2.95e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100125
SMART Domains Protein: ENSMUSP00000097701
Gene: ENSMUSG00000022760

DomainStartEndE-ValueType
THAP 3 99 5e-20 SMART
DM3 25 98 4.22e-20 SMART
low complexity region 118 130 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
coiled coil region 239 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231288
Predicted Effect possibly damaging
Transcript: ENSMUST00000231292
AA Change: E638G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000231307
AA Change: E320G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000231424
Predicted Effect probably benign
Transcript: ENSMUST00000231548
Predicted Effect probably benign
Transcript: ENSMUST00000231994
Predicted Effect probably benign
Transcript: ENSMUST00000232041
Predicted Effect probably benign
Transcript: ENSMUST00000232114
Predicted Effect probably benign
Transcript: ENSMUST00000232372
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a member of the BR-C, ttk and bab-kelch superfamily that, in humans, localizes to the Golgi network and is associated with the ras / mitogen-activated protein kinase pathway. Loss-of-function mutations in the human ortholog are associated with glioblastoma multiforme, schwannomatosis, Noonan syndrome, and DiGeorge syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Lztr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lztr1 APN 16 17517450 splice site probably benign
IGL01152:Lztr1 APN 16 17522453 missense probably damaging 1.00
IGL01501:Lztr1 APN 16 17522391 unclassified probably null
IGL01512:Lztr1 APN 16 17522391 unclassified probably null
IGL01514:Lztr1 APN 16 17522391 unclassified probably null
IGL01516:Lztr1 APN 16 17522391 unclassified probably null
IGL01933:Lztr1 APN 16 17520591 missense probably damaging 1.00
IGL02603:Lztr1 APN 16 17509686 missense possibly damaging 0.77
IGL03012:Lztr1 APN 16 17521484 missense possibly damaging 0.92
IGL03191:Lztr1 APN 16 17518528 missense probably damaging 1.00
R0331:Lztr1 UTSW 16 17524237 unclassified probably benign
R0717:Lztr1 UTSW 16 17516048 unclassified probably null
R1511:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R1925:Lztr1 UTSW 16 17523383 missense probably damaging 1.00
R2062:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R3694:Lztr1 UTSW 16 17509061 missense possibly damaging 0.90
R3935:Lztr1 UTSW 16 17522195 nonsense probably null
R4645:Lztr1 UTSW 16 17524091 unclassified probably benign
R5624:Lztr1 UTSW 16 17512129 splice site probably benign
R7175:Lztr1 UTSW 16 17523031 missense possibly damaging 0.84
R7420:Lztr1 UTSW 16 17524129 missense probably damaging 1.00
R7515:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R7516:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTGGCACTTCTGGCTTTGG -3'
(R):5'- AATGGAGATGTTCACCTGCC -3'

Sequencing Primer
(F):5'- CACTTCTGGCTTTGGGAAAC -3'
(R):5'- ATGGCCTCAAAGTAGCTGC -3'
Posted On2019-06-26