Mutagenetix > Incidental Mutations

Incidental Mutation 'R7223:Tpp2'

561910

Institutional Source

Beutler Lab

Gene Symbol

Tpp2

Ensembl Gene

ENSMUSG00000041763

Gene Name

tripeptidyl peptidase II

Synonyms

TppII

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.462) question?

Stock #

R7223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43933647-44003000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43968888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 417 (D417E)

Ref Sequence

ENSEMBL: ENSMUSP00000085244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]

AlphaFold

Q64514

Predicted Effect

probably damaging
Transcript: ENSMUST00000087933
AA Change: D417E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: D417E

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	35	500	1.4e-96	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	777	964	2.4e-80	PFAM
low complexity region	1017	1033	N/A	INTRINSIC
PDB:3LXU\|X	1034	1262	1e-20	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000186441

Predicted Effect

probably damaging
Transcript: ENSMUST00000188302
AA Change: D417E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763
AA Change: D417E

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	4.3e-84	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188313
AA Change: D417E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: D417E

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	5.1e-83	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	966	2.7e-93	PFAM
low complexity region	1004	1020	N/A	INTRINSIC
PDB:3LXU\|X	1021	1249	1e-20	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000189388
AA Change: D417E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: D417E

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	2.3e-81	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	880	7.8e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,274,143	V733E	probably benign	Het
Adam34	A	T	8: 43,652,004	N201K	probably benign	Het
Aldh3b2	A	C	19: 3,979,592	S322R	probably damaging	Het
Anpep	A	T	7: 79,825,310	L914Q	probably damaging	Het
Arhgap30	T	C	1: 171,407,571	F535S	probably damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Baz2a	G	T	10: 128,112,606	G252V	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Carmil3	T	C	14: 55,496,238	F359S	possibly damaging	Het
Ccdc124	A	T	8: 70,868,526	L190Q	probably damaging	Het
Ccr6	T	C	17: 8,256,140	V59A	probably damaging	Het
Ccr8	T	A	9: 120,094,617	I266N	probably damaging	Het
Cdh23	T	A	10: 60,331,817	E1798V	probably damaging	Het
Cdk5rap2	T	C	4: 70,235,447	N1713S	probably benign	Het
Cep19	T	A	16: 32,104,015	I33N	probably damaging	Het
Cers3	A	T	7: 66,783,415	Y196F	probably damaging	Het
Cidea	T	C	18: 67,366,421	I126T	probably damaging	Het
Copg2	A	T	6: 30,812,754	Y546*	probably null	Het
Cul3	A	T	1: 80,287,000	V261E	probably benign	Het
Cyp2g1	A	T	7: 26,814,632	D221V	probably damaging	Het
Cyp8b1	G	A	9: 121,915,097	H390Y	probably damaging	Het
Daam1	T	C	12: 71,988,943	F971L	probably damaging	Het
Dnajc24	G	A	2: 106,001,966	S24L	possibly damaging	Het
Dpysl3	T	C	18: 43,438,042	S56G	probably benign	Het
Esp1	A	G	17: 40,731,081	D88G	probably benign	Het
Fam171b	A	G	2: 83,878,230	T359A	probably damaging	Het
Fam186b	T	C	15: 99,279,837	E536G	possibly damaging	Het
Fbxo3	T	C	2: 104,043,012	V156A	possibly damaging	Het
Gls2	C	A	10: 128,199,194	H65Q	probably benign	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpcpd1	T	A	2: 132,534,056	K435I	probably benign	Het
Gpx6	T	A	13: 21,317,670		probably null	Het
Hps3	A	T	3: 20,030,419	S202T	probably benign	Het
Htr1d	T	A	4: 136,443,501	L347H	probably damaging	Het
Igfals	T	C	17: 24,881,234	L433P	probably damaging	Het
Ilvbl	C	T	10: 78,583,696	H537Y	probably benign	Het
Iqgap2	A	T	13: 95,628,972	M1530K	probably damaging	Het
Jarid2	A	G	13: 44,896,322	T247A	possibly damaging	Het
L3hypdh	C	T	12: 72,074,009	V323I	possibly damaging	Het
Lama3	C	T	18: 12,582,608	T1707I	possibly damaging	Het
Map6	G	T	7: 99,268,025	A2S	probably damaging	Het
Mfap3	T	A	11: 57,530,240	I349K	probably benign	Het
Mybl2	A	G	2: 163,072,705	T248A	probably benign	Het
N6amt1	A	G	16: 87,362,660	*151W	probably null	Het
Nhlrc1	A	G	13: 47,014,208	V191A	probably benign	Het
Nkx2-5	T	C	17: 26,839,620	E120G	possibly damaging	Het
Olfr1066	T	A	2: 86,455,867	I135F	possibly damaging	Het
Olfr1380	T	A	11: 49,564,098	M59K	probably damaging	Het
Olfr582	C	A	7: 103,041,632	T46N	possibly damaging	Het
Olfr890	T	C	9: 38,143,753	V201A	probably benign	Het
Pcdha8	T	G	18: 36,993,148	L228V	probably benign	Het
Pcsk2	A	G	2: 143,690,333	T134A	possibly damaging	Het
Phldb3	G	A	7: 24,624,653	R484Q	probably benign	Het
Pipox	A	G	11: 77,881,186	S371P	probably damaging	Het
Plekhg1	T	C	10: 3,873,343	S159P		Het
Psme4	C	T	11: 30,874,226	P1737S	probably benign	Het
Pygm	G	A	19: 6,388,863	D328N	probably benign	Het
Rabgef1	A	T	5: 130,190,960	E88V	probably benign	Het
Rims2	G	T	15: 39,437,032	R245L	probably benign	Het
Slc38a4	T	C	15: 97,010,345	I172V	probably damaging	Het
Slc4a10	T	A	2: 62,268,665	Y586N	probably damaging	Het
Snap91	C	T	9: 86,879,557		probably benign	Het
Sorcs1	C	T	19: 50,190,042	V881I	probably benign	Het
Spef2	A	T	15: 9,601,640	V1512E	unknown	Het
Sufu	T	C	19: 46,453,277	I292T	possibly damaging	Het
Tet1	T	C	10: 62,813,671	N87D	possibly damaging	Het
Tmem108	T	C	9: 103,499,534	T239A	not run	Het
Tmem121	A	T	12: 113,188,494	K111*	probably null	Het
Tpr	G	A	1: 150,439,256	E2025K	possibly damaging	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Ttn	T	C	2: 76,890,981	D6754G	probably null	Het
Unc13c	T	A	9: 73,629,191	M1627L	probably benign	Het
Ush2a	A	G	1: 188,810,217	I3327V	probably benign	Het
Vmn1r74	C	T	7: 11,846,967	Q65*	probably null	Het
Wdr18	G	A	10: 79,960,368	R69H	probably damaging	Het
Zbed5	G	T	5: 129,900,438	D132Y	probably damaging	Het
Zfp644	A	T	5: 106,637,582	Y366*	probably null	Het
Zfyve26	T	C	12: 79,246,171	N2068S	probably damaging	Het
Zic2	T	C	14: 122,476,091	F139S	probably damaging	Het
Zmynd11	T	C	13: 9,710,162	Q141R	probably benign	Het
Zrsr1	A	G	11: 22,973,388	E54G	probably benign	Het
Zscan10	G	A	17: 23,609,482	D333N	probably benign	Het

Other mutations in Tpp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Tpp2	APN	1	43983291	missense	possibly damaging	0.90
IGL01021:Tpp2	APN	1	43934187	nonsense	probably null
IGL01096:Tpp2	APN	1	43960888	missense	probably damaging	1.00
IGL01344:Tpp2	APN	1	43983262	missense	probably benign	0.04
IGL01642:Tpp2	APN	1	43954653	missense	probably damaging	1.00
IGL02719:Tpp2	APN	1	43940231	missense	probably benign	0.09
IGL02890:Tpp2	APN	1	43999690	missense	probably damaging	1.00
IGL03102:Tpp2	APN	1	43956489	missense	probably damaging	1.00
IGL03175:Tpp2	APN	1	43973511	missense	probably benign	0.35
beaver	UTSW	1	43971715	missense	probably benign	0.08
billingsly	UTSW	1	43983552	missense	probably damaging	1.00
cleaver	UTSW	1	43978508	nonsense	probably null
dow	UTSW	1	43970392	splice site	probably benign
Eddie	UTSW	1	43968988	missense	probably damaging	1.00
June	UTSW	1	43954710	missense	probably damaging	1.00
landers	UTSW	1	43977255	missense	probably damaging	1.00
mathers	UTSW	1	43992268	missense	probably damaging	1.00
state	UTSW	1	43978438	missense	possibly damaging	0.48
wally	UTSW	1	43992396	critical splice donor site	probably null
Ward	UTSW	1	43954736	missense	possibly damaging	0.82
wilson	UTSW	1	43972689	critical splice donor site	probably null
BB010:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
BB020:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R0001:Tpp2	UTSW	1	43971726	missense	probably benign	0.00
R0003:Tpp2	UTSW	1	43960139	missense	possibly damaging	0.94
R0066:Tpp2	UTSW	1	43981748	missense	possibly damaging	0.56
R0110:Tpp2	UTSW	1	43999693	missense	probably damaging	1.00
R0110:Tpp2	UTSW	1	43978504	missense	probably benign	0.00
R0167:Tpp2	UTSW	1	43970488	missense	probably benign	0.01
R0441:Tpp2	UTSW	1	43990562	missense	possibly damaging	0.85
R0520:Tpp2	UTSW	1	43990530	missense	probably damaging	1.00
R0639:Tpp2	UTSW	1	43975447	missense	probably benign	0.00
R1118:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1119:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1593:Tpp2	UTSW	1	43975433	missense	probably benign	0.01
R1702:Tpp2	UTSW	1	43990548	missense	probably damaging	0.99
R1756:Tpp2	UTSW	1	43978725	splice site	probably null
R2066:Tpp2	UTSW	1	43978438	missense	possibly damaging	0.48
R2171:Tpp2	UTSW	1	43957446	missense	probably benign	0.00
R2378:Tpp2	UTSW	1	43999765	missense	probably damaging	0.99
R2394:Tpp2	UTSW	1	43983186	missense	possibly damaging	0.83
R2507:Tpp2	UTSW	1	44001449	missense	probably benign	0.31
R2879:Tpp2	UTSW	1	43971623	missense	probably damaging	1.00
R3436:Tpp2	UTSW	1	43940144	missense	probably damaging	0.99
R4106:Tpp2	UTSW	1	44001457	missense	possibly damaging	0.71
R4658:Tpp2	UTSW	1	43954710	missense	probably damaging	1.00
R4760:Tpp2	UTSW	1	43971715	missense	probably benign	0.08
R4963:Tpp2	UTSW	1	43992268	missense	probably damaging	1.00
R5049:Tpp2	UTSW	1	44001473	missense	possibly damaging	0.46
R5073:Tpp2	UTSW	1	43954736	missense	possibly damaging	0.82
R6010:Tpp2	UTSW	1	43951213	critical splice donor site	probably null
R6118:Tpp2	UTSW	1	43940146	missense	probably damaging	1.00
R6155:Tpp2	UTSW	1	43956489	missense	probably damaging	1.00
R6169:Tpp2	UTSW	1	43983579	missense	probably damaging	0.99
R6236:Tpp2	UTSW	1	43977317	missense	probably benign	0.01
R6695:Tpp2	UTSW	1	43983276	missense	probably benign
R6845:Tpp2	UTSW	1	43978508	nonsense	probably null
R7054:Tpp2	UTSW	1	43983158	missense	probably damaging	1.00
R7094:Tpp2	UTSW	1	43968988	missense	probably damaging	1.00
R7316:Tpp2	UTSW	1	43970431	missense	probably benign	0.00
R7324:Tpp2	UTSW	1	43978778	missense	probably damaging	1.00
R7363:Tpp2	UTSW	1	43985422	missense	probably benign	0.00
R7454:Tpp2	UTSW	1	43954659	missense	probably benign	0.01
R7496:Tpp2	UTSW	1	43983517	missense	probably benign	0.09
R7699:Tpp2	UTSW	1	43970466	missense	probably benign
R7700:Tpp2	UTSW	1	43970466	missense	probably benign
R7804:Tpp2	UTSW	1	43983281	missense	probably benign	0.00
R7933:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R7979:Tpp2	UTSW	1	43940137	missense	probably benign	0.35
R8032:Tpp2	UTSW	1	43975468	missense	possibly damaging	0.82
R8101:Tpp2	UTSW	1	43970440	missense	probably damaging	1.00
R8245:Tpp2	UTSW	1	43983552	missense	probably damaging	1.00
R8314:Tpp2	UTSW	1	43934227	missense	probably benign	0.10
R8518:Tpp2	UTSW	1	43980385	missense	probably damaging	1.00
R8519:Tpp2	UTSW	1	43977205	critical splice acceptor site	probably null
R8529:Tpp2	UTSW	1	43983140	missense	probably benign
R8756:Tpp2	UTSW	1	43960135	nonsense	probably null
R8765:Tpp2	UTSW	1	43972689	critical splice donor site	probably null
R8773:Tpp2	UTSW	1	43970392	splice site	probably benign
R8915:Tpp2	UTSW	1	43977255	missense	probably damaging	1.00
R9049:Tpp2	UTSW	1	43953342	missense	possibly damaging	0.66
R9090:Tpp2	UTSW	1	43954651	missense	probably damaging	1.00
R9176:Tpp2	UTSW	1	43992393	missense	probably null	0.29
R9214:Tpp2	UTSW	1	43992354	missense	probably benign
R9271:Tpp2	UTSW	1	43954651	missense	probably damaging	1.00
R9316:Tpp2	UTSW	1	43978444	missense	probably damaging	0.97
R9371:Tpp2	UTSW	1	43960209	missense	probably damaging	1.00
R9422:Tpp2	UTSW	1	43978737	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AAATAACTGACCCCTATGCCTTTC -3'
(R):5'- CCATGAGAACTTCAGAAAGTATAGCC -3'

Sequencing Primer
(F):5'- GCCTTTCTCACATAAACATAGATAGC -3'
(R):5'- AAAGTACCAGGGCAATGC -3'

Posted On

2019-06-26