Incidental Mutation 'R7223:Tpp2'
ID 561910
Institutional Source Beutler Lab
Gene Symbol Tpp2
Ensembl Gene ENSMUSG00000041763
Gene Name tripeptidyl peptidase II
Synonyms TppII
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock # R7223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 43933647-44003000 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43968888 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 417 (D417E)
Ref Sequence ENSEMBL: ENSMUSP00000085244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]
AlphaFold Q64514
Predicted Effect probably damaging
Transcript: ENSMUST00000087933
AA Change: D417E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: D417E

DomainStartEndE-ValueType
Pfam:Peptidase_S8 35 500 1.4e-96 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 777 964 2.4e-80 PFAM
low complexity region 1017 1033 N/A INTRINSIC
PDB:3LXU|X 1034 1262 1e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186441
Predicted Effect probably damaging
Transcript: ENSMUST00000188302
AA Change: D417E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763
AA Change: D417E

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 4.3e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188313
AA Change: D417E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: D417E

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 5.1e-83 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 966 2.7e-93 PFAM
low complexity region 1004 1020 N/A INTRINSIC
PDB:3LXU|X 1021 1249 1e-20 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000189388
AA Change: D417E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: D417E

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 2.3e-81 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 880 7.8e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Tpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tpp2 APN 1 43983291 missense possibly damaging 0.90
IGL01021:Tpp2 APN 1 43934187 nonsense probably null
IGL01096:Tpp2 APN 1 43960888 missense probably damaging 1.00
IGL01344:Tpp2 APN 1 43983262 missense probably benign 0.04
IGL01642:Tpp2 APN 1 43954653 missense probably damaging 1.00
IGL02719:Tpp2 APN 1 43940231 missense probably benign 0.09
IGL02890:Tpp2 APN 1 43999690 missense probably damaging 1.00
IGL03102:Tpp2 APN 1 43956489 missense probably damaging 1.00
IGL03175:Tpp2 APN 1 43973511 missense probably benign 0.35
beaver UTSW 1 43971715 missense probably benign 0.08
billingsly UTSW 1 43983552 missense probably damaging 1.00
cleaver UTSW 1 43978508 nonsense probably null
dow UTSW 1 43970392 splice site probably benign
Eddie UTSW 1 43968988 missense probably damaging 1.00
June UTSW 1 43954710 missense probably damaging 1.00
landers UTSW 1 43977255 missense probably damaging 1.00
mathers UTSW 1 43992268 missense probably damaging 1.00
state UTSW 1 43978438 missense possibly damaging 0.48
wally UTSW 1 43992396 critical splice donor site probably null
Ward UTSW 1 43954736 missense possibly damaging 0.82
wilson UTSW 1 43972689 critical splice donor site probably null
BB010:Tpp2 UTSW 1 43960961 missense probably damaging 1.00
BB020:Tpp2 UTSW 1 43960961 missense probably damaging 1.00
R0001:Tpp2 UTSW 1 43971726 missense probably benign 0.00
R0003:Tpp2 UTSW 1 43960139 missense possibly damaging 0.94
R0066:Tpp2 UTSW 1 43981748 missense possibly damaging 0.56
R0110:Tpp2 UTSW 1 43999693 missense probably damaging 1.00
R0110:Tpp2 UTSW 1 43978504 missense probably benign 0.00
R0167:Tpp2 UTSW 1 43970488 missense probably benign 0.01
R0441:Tpp2 UTSW 1 43990562 missense possibly damaging 0.85
R0520:Tpp2 UTSW 1 43990530 missense probably damaging 1.00
R0639:Tpp2 UTSW 1 43975447 missense probably benign 0.00
R1118:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1119:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1593:Tpp2 UTSW 1 43975433 missense probably benign 0.01
R1702:Tpp2 UTSW 1 43990548 missense probably damaging 0.99
R1756:Tpp2 UTSW 1 43978725 splice site probably null
R2066:Tpp2 UTSW 1 43978438 missense possibly damaging 0.48
R2171:Tpp2 UTSW 1 43957446 missense probably benign 0.00
R2378:Tpp2 UTSW 1 43999765 missense probably damaging 0.99
R2394:Tpp2 UTSW 1 43983186 missense possibly damaging 0.83
R2507:Tpp2 UTSW 1 44001449 missense probably benign 0.31
R2879:Tpp2 UTSW 1 43971623 missense probably damaging 1.00
R3436:Tpp2 UTSW 1 43940144 missense probably damaging 0.99
R4106:Tpp2 UTSW 1 44001457 missense possibly damaging 0.71
R4658:Tpp2 UTSW 1 43954710 missense probably damaging 1.00
R4760:Tpp2 UTSW 1 43971715 missense probably benign 0.08
R4963:Tpp2 UTSW 1 43992268 missense probably damaging 1.00
R5049:Tpp2 UTSW 1 44001473 missense possibly damaging 0.46
R5073:Tpp2 UTSW 1 43954736 missense possibly damaging 0.82
R6010:Tpp2 UTSW 1 43951213 critical splice donor site probably null
R6118:Tpp2 UTSW 1 43940146 missense probably damaging 1.00
R6155:Tpp2 UTSW 1 43956489 missense probably damaging 1.00
R6169:Tpp2 UTSW 1 43983579 missense probably damaging 0.99
R6236:Tpp2 UTSW 1 43977317 missense probably benign 0.01
R6695:Tpp2 UTSW 1 43983276 missense probably benign
R6845:Tpp2 UTSW 1 43978508 nonsense probably null
R7054:Tpp2 UTSW 1 43983158 missense probably damaging 1.00
R7094:Tpp2 UTSW 1 43968988 missense probably damaging 1.00
R7316:Tpp2 UTSW 1 43970431 missense probably benign 0.00
R7324:Tpp2 UTSW 1 43978778 missense probably damaging 1.00
R7363:Tpp2 UTSW 1 43985422 missense probably benign 0.00
R7454:Tpp2 UTSW 1 43954659 missense probably benign 0.01
R7496:Tpp2 UTSW 1 43983517 missense probably benign 0.09
R7699:Tpp2 UTSW 1 43970466 missense probably benign
R7700:Tpp2 UTSW 1 43970466 missense probably benign
R7804:Tpp2 UTSW 1 43983281 missense probably benign 0.00
R7933:Tpp2 UTSW 1 43960961 missense probably damaging 1.00
R7979:Tpp2 UTSW 1 43940137 missense probably benign 0.35
R8032:Tpp2 UTSW 1 43975468 missense possibly damaging 0.82
R8101:Tpp2 UTSW 1 43970440 missense probably damaging 1.00
R8245:Tpp2 UTSW 1 43983552 missense probably damaging 1.00
R8314:Tpp2 UTSW 1 43934227 missense probably benign 0.10
R8518:Tpp2 UTSW 1 43980385 missense probably damaging 1.00
R8519:Tpp2 UTSW 1 43977205 critical splice acceptor site probably null
R8529:Tpp2 UTSW 1 43983140 missense probably benign
R8756:Tpp2 UTSW 1 43960135 nonsense probably null
R8765:Tpp2 UTSW 1 43972689 critical splice donor site probably null
R8773:Tpp2 UTSW 1 43970392 splice site probably benign
R8915:Tpp2 UTSW 1 43977255 missense probably damaging 1.00
R9049:Tpp2 UTSW 1 43953342 missense possibly damaging 0.66
R9090:Tpp2 UTSW 1 43954651 missense probably damaging 1.00
R9176:Tpp2 UTSW 1 43992393 missense probably null 0.29
R9214:Tpp2 UTSW 1 43992354 missense probably benign
R9271:Tpp2 UTSW 1 43954651 missense probably damaging 1.00
R9316:Tpp2 UTSW 1 43978444 missense probably damaging 0.97
R9371:Tpp2 UTSW 1 43960209 missense probably damaging 1.00
R9422:Tpp2 UTSW 1 43978737 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAATAACTGACCCCTATGCCTTTC -3'
(R):5'- CCATGAGAACTTCAGAAAGTATAGCC -3'

Sequencing Primer
(F):5'- GCCTTTCTCACATAAACATAGATAGC -3'
(R):5'- AAAGTACCAGGGCAATGC -3'
Posted On 2019-06-26