Mutagenetix > Incidental Mutations

Incidental Mutation 'R7223:Slc4a10'

561916

Institutional Source

Beutler Lab

Gene Symbol

Slc4a10

Ensembl Gene

ENSMUSG00000026904

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter-like, member 10

Synonyms

NCBE

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62046462-62326730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 62268665 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 586 (Y586N)

Ref Sequence

ENSEMBL: ENSMUSP00000108099 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]

AlphaFold

Q5DTL9

Predicted Effect

probably damaging
Transcript: ENSMUST00000054484
AA Change: Y556N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: Y556N

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	9e-107	PFAM
Pfam:HCO3_cotransp	445	959	1e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102735
AA Change: Y556N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: Y556N

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	2e-106	PFAM
Pfam:HCO3_cotransp	445	959	2.4e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112480
AA Change: Y586N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: Y586N

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	435	9.6e-108	PFAM
Pfam:HCO3_cotransp	476	989	1.5e-245	PFAM
transmembrane domain	997	1019	N/A	INTRINSIC
low complexity region	1041	1055	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,274,143	V733E	probably benign	Het
Adam34	A	T	8: 43,652,004	N201K	probably benign	Het
Aldh3b2	A	C	19: 3,979,592	S322R	probably damaging	Het
Anpep	A	T	7: 79,825,310	L914Q	probably damaging	Het
Arhgap30	T	C	1: 171,407,571	F535S	probably damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Baz2a	G	T	10: 128,112,606	G252V	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Carmil3	T	C	14: 55,496,238	F359S	possibly damaging	Het
Ccdc124	A	T	8: 70,868,526	L190Q	probably damaging	Het
Ccr6	T	C	17: 8,256,140	V59A	probably damaging	Het
Ccr8	T	A	9: 120,094,617	I266N	probably damaging	Het
Cdh23	T	A	10: 60,331,817	E1798V	probably damaging	Het
Cdk5rap2	T	C	4: 70,235,447	N1713S	probably benign	Het
Cep19	T	A	16: 32,104,015	I33N	probably damaging	Het
Cers3	A	T	7: 66,783,415	Y196F	probably damaging	Het
Cidea	T	C	18: 67,366,421	I126T	probably damaging	Het
Copg2	A	T	6: 30,812,754	Y546*	probably null	Het
Cul3	A	T	1: 80,287,000	V261E	probably benign	Het
Cyp2g1	A	T	7: 26,814,632	D221V	probably damaging	Het
Cyp8b1	G	A	9: 121,915,097	H390Y	probably damaging	Het
Daam1	T	C	12: 71,988,943	F971L	probably damaging	Het
Dnajc24	G	A	2: 106,001,966	S24L	possibly damaging	Het
Dpysl3	T	C	18: 43,438,042	S56G	probably benign	Het
Esp1	A	G	17: 40,731,081	D88G	probably benign	Het
Fam171b	A	G	2: 83,878,230	T359A	probably damaging	Het
Fam186b	T	C	15: 99,279,837	E536G	possibly damaging	Het
Fbxo3	T	C	2: 104,043,012	V156A	possibly damaging	Het
Gls2	C	A	10: 128,199,194	H65Q	probably benign	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpcpd1	T	A	2: 132,534,056	K435I	probably benign	Het
Gpx6	T	A	13: 21,317,670		probably null	Het
Hps3	A	T	3: 20,030,419	S202T	probably benign	Het
Htr1d	T	A	4: 136,443,501	L347H	probably damaging	Het
Igfals	T	C	17: 24,881,234	L433P	probably damaging	Het
Ilvbl	C	T	10: 78,583,696	H537Y	probably benign	Het
Iqgap2	A	T	13: 95,628,972	M1530K	probably damaging	Het
Jarid2	A	G	13: 44,896,322	T247A	possibly damaging	Het
L3hypdh	C	T	12: 72,074,009	V323I	possibly damaging	Het
Lama3	C	T	18: 12,582,608	T1707I	possibly damaging	Het
Map6	G	T	7: 99,268,025	A2S	probably damaging	Het
Mfap3	T	A	11: 57,530,240	I349K	probably benign	Het
Mybl2	A	G	2: 163,072,705	T248A	probably benign	Het
N6amt1	A	G	16: 87,362,660	*151W	probably null	Het
Nhlrc1	A	G	13: 47,014,208	V191A	probably benign	Het
Nkx2-5	T	C	17: 26,839,620	E120G	possibly damaging	Het
Olfr1066	T	A	2: 86,455,867	I135F	possibly damaging	Het
Olfr1380	T	A	11: 49,564,098	M59K	probably damaging	Het
Olfr582	C	A	7: 103,041,632	T46N	possibly damaging	Het
Olfr890	T	C	9: 38,143,753	V201A	probably benign	Het
Pcdha8	T	G	18: 36,993,148	L228V	probably benign	Het
Pcsk2	A	G	2: 143,690,333	T134A	possibly damaging	Het
Phldb3	G	A	7: 24,624,653	R484Q	probably benign	Het
Pipox	A	G	11: 77,881,186	S371P	probably damaging	Het
Plekhg1	T	C	10: 3,873,343	S159P		Het
Psme4	C	T	11: 30,874,226	P1737S	probably benign	Het
Pygm	G	A	19: 6,388,863	D328N	probably benign	Het
Rabgef1	A	T	5: 130,190,960	E88V	probably benign	Het
Rims2	G	T	15: 39,437,032	R245L	probably benign	Het
Slc38a4	T	C	15: 97,010,345	I172V	probably damaging	Het
Snap91	C	T	9: 86,879,557		probably benign	Het
Sorcs1	C	T	19: 50,190,042	V881I	probably benign	Het
Spef2	A	T	15: 9,601,640	V1512E	unknown	Het
Sufu	T	C	19: 46,453,277	I292T	possibly damaging	Het
Tet1	T	C	10: 62,813,671	N87D	possibly damaging	Het
Tmem108	T	C	9: 103,499,534	T239A	not run	Het
Tmem121	A	T	12: 113,188,494	K111*	probably null	Het
Tpp2	T	A	1: 43,968,888	D417E	probably damaging	Het
Tpr	G	A	1: 150,439,256	E2025K	possibly damaging	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Ttn	T	C	2: 76,890,981	D6754G	probably null	Het
Unc13c	T	A	9: 73,629,191	M1627L	probably benign	Het
Ush2a	A	G	1: 188,810,217	I3327V	probably benign	Het
Vmn1r74	C	T	7: 11,846,967	Q65*	probably null	Het
Wdr18	G	A	10: 79,960,368	R69H	probably damaging	Het
Zbed5	G	T	5: 129,900,438	D132Y	probably damaging	Het
Zfp644	A	T	5: 106,637,582	Y366*	probably null	Het
Zfyve26	T	C	12: 79,246,171	N2068S	probably damaging	Het
Zic2	T	C	14: 122,476,091	F139S	probably damaging	Het
Zmynd11	T	C	13: 9,710,162	Q141R	probably benign	Het
Zrsr1	A	G	11: 22,973,388	E54G	probably benign	Het
Zscan10	G	A	17: 23,609,482	D333N	probably benign	Het

Other mutations in Slc4a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Slc4a10	APN	2	62290001	missense	probably damaging	1.00
IGL00990:Slc4a10	APN	2	62286940	missense	probably damaging	1.00
IGL01294:Slc4a10	APN	2	62253309	critical splice acceptor site	probably null
IGL01628:Slc4a10	APN	2	62268666	missense	probably damaging	1.00
IGL01773:Slc4a10	APN	2	62190757	missense	probably damaging	0.97
IGL02119:Slc4a10	APN	2	62228670	missense	probably damaging	1.00
IGL02125:Slc4a10	APN	2	62268171	missense	probably benign	0.02
IGL02406:Slc4a10	APN	2	62190769	missense	probably benign	0.37
IGL02890:Slc4a10	APN	2	62286916	missense	probably damaging	1.00
IGL02959:Slc4a10	APN	2	62268143	missense	probably damaging	1.00
IGL02979:Slc4a10	APN	2	62288747	missense	probably null	1.00
IGL03144:Slc4a10	APN	2	62250466	missense	probably benign	0.00
IGL03175:Slc4a10	APN	2	62296960	missense	probably damaging	0.99
IGL03383:Slc4a10	APN	2	62267436	missense	probably damaging	1.00
IGL03412:Slc4a10	APN	2	62250543	splice site	probably benign
R0085:Slc4a10	UTSW	2	62244346	splice site	probably benign
R0401:Slc4a10	UTSW	2	62190848	missense	probably benign	0.27
R0433:Slc4a10	UTSW	2	62289983	missense	probably benign	0.01
R0482:Slc4a10	UTSW	2	62297017	splice site	probably benign
R0506:Slc4a10	UTSW	2	62250533	missense	probably benign	0.13
R0511:Slc4a10	UTSW	2	62286862	missense	probably damaging	0.97
R0590:Slc4a10	UTSW	2	62190893	splice site	probably benign
R0883:Slc4a10	UTSW	2	62243398	missense	probably benign	0.11
R1167:Slc4a10	UTSW	2	62228574	missense	probably damaging	1.00
R1276:Slc4a10	UTSW	2	62250443	missense	probably damaging	0.99
R1395:Slc4a10	UTSW	2	62313286	missense	probably benign	0.00
R1455:Slc4a10	UTSW	2	62286930	missense	probably damaging	1.00
R1589:Slc4a10	UTSW	2	62257462	missense	probably damaging	1.00
R1677:Slc4a10	UTSW	2	62324727	missense	probably benign
R1848:Slc4a10	UTSW	2	62316606	missense	probably damaging	1.00
R1987:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R1988:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R2018:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2019:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2407:Slc4a10	UTSW	2	62313343	missense	probably benign
R4067:Slc4a10	UTSW	2	62046645	start codon destroyed	probably benign	0.00
R4184:Slc4a10	UTSW	2	62317442	intron	probably benign
R4255:Slc4a10	UTSW	2	62281936	missense	probably benign	0.10
R4282:Slc4a10	UTSW	2	62244343	splice site	probably null
R4296:Slc4a10	UTSW	2	62234428	missense	possibly damaging	0.80
R4361:Slc4a10	UTSW	2	62243385	missense	probably benign	0.00
R4596:Slc4a10	UTSW	2	62296858	missense	probably damaging	1.00
R4709:Slc4a10	UTSW	2	62257517	missense	probably null	1.00
R4755:Slc4a10	UTSW	2	62296988	missense	probably damaging	1.00
R4836:Slc4a10	UTSW	2	62268187	missense	probably damaging	1.00
R4841:Slc4a10	UTSW	2	62257595	missense	possibly damaging	0.68
R4998:Slc4a10	UTSW	2	62244439	missense	probably benign	0.00
R5069:Slc4a10	UTSW	2	62267571	missense	probably benign	0.06
R5223:Slc4a10	UTSW	2	62253366	missense	probably damaging	1.00
R5244:Slc4a10	UTSW	2	62288725	missense	probably damaging	1.00
R5386:Slc4a10	UTSW	2	62290058	missense	probably damaging	1.00
R5808:Slc4a10	UTSW	2	62250472	missense	probably damaging	1.00
R5999:Slc4a10	UTSW	2	62243431	missense	probably benign	0.10
R6007:Slc4a10	UTSW	2	62268872	missense	probably benign	0.44
R6009:Slc4a10	UTSW	2	62046690	missense	probably benign	0.00
R6015:Slc4a10	UTSW	2	62228702	missense	probably benign	0.05
R6103:Slc4a10	UTSW	2	62234465	missense	probably damaging	1.00
R6141:Slc4a10	UTSW	2	62211445	missense	probably damaging	1.00
R6193:Slc4a10	UTSW	2	62243357	splice site	probably null
R6217:Slc4a10	UTSW	2	62303951	missense	probably benign	0.27
R6280:Slc4a10	UTSW	2	62281966	missense	probably benign	0.05
R6523:Slc4a10	UTSW	2	62286961	nonsense	probably null
R6643:Slc4a10	UTSW	2	62228710	missense	possibly damaging	0.96
R6660:Slc4a10	UTSW	2	62250403	missense	possibly damaging	0.55
R7008:Slc4a10	UTSW	2	62286922	missense	probably benign	0.00
R7083:Slc4a10	UTSW	2	62234495	missense	probably benign	0.03
R7243:Slc4a10	UTSW	2	62303862	missense	probably damaging	1.00
R7449:Slc4a10	UTSW	2	62303946	missense	probably benign
R7621:Slc4a10	UTSW	2	62250479	missense	probably damaging	0.98
R7692:Slc4a10	UTSW	2	62303964	missense	possibly damaging	0.94
R7742:Slc4a10	UTSW	2	62296850	missense	probably damaging	1.00
R7905:Slc4a10	UTSW	2	62268151	missense	probably damaging	1.00
R8179:Slc4a10	UTSW	2	62243448	missense	possibly damaging	0.64
R8528:Slc4a10	UTSW	2	62296796	missense	possibly damaging	0.79
R8531:Slc4a10	UTSW	2	62267507	missense	probably damaging	1.00
R8772:Slc4a10	UTSW	2	62303940	missense	probably damaging	1.00
R9307:Slc4a10	UTSW	2	62253318	missense	probably damaging	1.00
U24488:Slc4a10	UTSW	2	62046658	missense	probably benign	0.05
X0019:Slc4a10	UTSW	2	62228599	missense	probably damaging	1.00
Z1088:Slc4a10	UTSW	2	62228571	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62211379	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62244416	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAACATCATCGCTGTTGGAGG -3'
(R):5'- AACAACTTCTCCAGGGCTTC -3'

Sequencing Primer
(F):5'- GTGCTAAGAACCCCCTACTAGCTTG -3'
(R):5'- CTCCAGGGCTTCATAGATAAAAATG -3'

Posted On

2019-06-26