Incidental Mutation 'R7223:Fam171b'
ID 561919
Institutional Source Beutler Lab
Gene Symbol Fam171b
Ensembl Gene ENSMUSG00000048388
Gene Name family with sequence similarity 171, member B
Synonyms D430039N05Rik
MMRRC Submission 045295-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R7223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 83642980-83713830 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83708574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 359 (T359A)
Ref Sequence ENSEMBL: ENSMUSP00000062702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051454]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051454
AA Change: T359A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062702
Gene: ENSMUSG00000048388
AA Change: T359A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
Pfam:UPF0560 80 591 4.3e-101 PFAM
Pfam:UPF0560 583 821 6.7e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,104,487 (GRCm39) V733E probably benign Het
Adam34 A T 8: 44,105,041 (GRCm39) N201K probably benign Het
Aldh3b2 A C 19: 4,029,592 (GRCm39) S322R probably damaging Het
Anpep A T 7: 79,475,058 (GRCm39) L914Q probably damaging Het
Arhgap30 T C 1: 171,235,139 (GRCm39) F535S probably damaging Het
Baiap3 G A 17: 25,462,814 (GRCm39) R1075C probably benign Het
Baz2a G T 10: 127,948,475 (GRCm39) G252V probably damaging Het
Brinp3 T A 1: 146,776,812 (GRCm39) S420T possibly damaging Het
Carmil3 T C 14: 55,733,695 (GRCm39) F359S possibly damaging Het
Ccdc124 A T 8: 71,321,170 (GRCm39) L190Q probably damaging Het
Ccr6 T C 17: 8,474,972 (GRCm39) V59A probably damaging Het
Ccr8 T A 9: 119,923,683 (GRCm39) I266N probably damaging Het
Cdh23 T A 10: 60,167,596 (GRCm39) E1798V probably damaging Het
Cdk5rap2 T C 4: 70,153,684 (GRCm39) N1713S probably benign Het
Cep19 T A 16: 31,922,833 (GRCm39) I33N probably damaging Het
Cers3 A T 7: 66,433,163 (GRCm39) Y196F probably damaging Het
Cidea T C 18: 67,499,491 (GRCm39) I126T probably damaging Het
Copg2 A T 6: 30,789,689 (GRCm39) Y546* probably null Het
Cul3 A T 1: 80,264,717 (GRCm39) V261E probably benign Het
Cyp2g1 A T 7: 26,514,057 (GRCm39) D221V probably damaging Het
Cyp8b1 G A 9: 121,744,163 (GRCm39) H390Y probably damaging Het
Daam1 T C 12: 72,035,717 (GRCm39) F971L probably damaging Het
Dnajc24 G A 2: 105,832,311 (GRCm39) S24L possibly damaging Het
Dpysl3 T C 18: 43,571,107 (GRCm39) S56G probably benign Het
Esp1 A G 17: 41,041,972 (GRCm39) D88G probably benign Het
Fam186b T C 15: 99,177,718 (GRCm39) E536G possibly damaging Het
Fbxo3 T C 2: 103,873,357 (GRCm39) V156A possibly damaging Het
Gls2 C A 10: 128,035,063 (GRCm39) H65Q probably benign Het
Gp2 A G 7: 119,050,721 (GRCm39) probably null Het
Gpcpd1 T A 2: 132,375,976 (GRCm39) K435I probably benign Het
Gpx6 T A 13: 21,501,840 (GRCm39) probably null Het
Hps3 A T 3: 20,084,583 (GRCm39) S202T probably benign Het
Htr1d T A 4: 136,170,812 (GRCm39) L347H probably damaging Het
Igfals T C 17: 25,100,208 (GRCm39) L433P probably damaging Het
Ilvbl C T 10: 78,419,530 (GRCm39) H537Y probably benign Het
Iqgap2 A T 13: 95,765,480 (GRCm39) M1530K probably damaging Het
Jarid2 A G 13: 45,049,798 (GRCm39) T247A possibly damaging Het
L3hypdh C T 12: 72,120,783 (GRCm39) V323I possibly damaging Het
Lama3 C T 18: 12,715,665 (GRCm39) T1707I possibly damaging Het
Map6 G T 7: 98,917,232 (GRCm39) A2S probably damaging Het
Mfap3 T A 11: 57,421,066 (GRCm39) I349K probably benign Het
Mybl2 A G 2: 162,914,625 (GRCm39) T248A probably benign Het
N6amt1 A G 16: 87,159,548 (GRCm39) *151W probably null Het
Nhlrc1 A G 13: 47,167,684 (GRCm39) V191A probably benign Het
Nkx2-5 T C 17: 27,058,594 (GRCm39) E120G possibly damaging Het
Or2y10 T A 11: 49,454,925 (GRCm39) M59K probably damaging Het
Or52r1b C A 7: 102,690,839 (GRCm39) T46N possibly damaging Het
Or8b41 T C 9: 38,055,049 (GRCm39) V201A probably benign Het
Or8k28 T A 2: 86,286,211 (GRCm39) I135F possibly damaging Het
Pcdha8 T G 18: 37,126,201 (GRCm39) L228V probably benign Het
Pcsk2 A G 2: 143,532,253 (GRCm39) T134A possibly damaging Het
Phldb3 G A 7: 24,324,078 (GRCm39) R484Q probably benign Het
Pipox A G 11: 77,772,012 (GRCm39) S371P probably damaging Het
Plekhg1 T C 10: 3,823,343 (GRCm39) S159P Het
Psme4 C T 11: 30,824,226 (GRCm39) P1737S probably benign Het
Pygm G A 19: 6,438,893 (GRCm39) D328N probably benign Het
Rabgef1 A T 5: 130,219,801 (GRCm39) E88V probably benign Het
Rims2 G T 15: 39,300,428 (GRCm39) R245L probably benign Het
Slc38a4 T C 15: 96,908,226 (GRCm39) I172V probably damaging Het
Slc4a10 T A 2: 62,099,009 (GRCm39) Y586N probably damaging Het
Snap91 C T 9: 86,761,610 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,178,480 (GRCm39) V881I probably benign Het
Spef2 A T 15: 9,601,726 (GRCm39) V1512E unknown Het
Sufu T C 19: 46,441,716 (GRCm39) I292T possibly damaging Het
Tet1 T C 10: 62,649,450 (GRCm39) N87D possibly damaging Het
Tmem108 T C 9: 103,376,733 (GRCm39) T239A not run Het
Tmem121 A T 12: 113,152,114 (GRCm39) K111* probably null Het
Tpp2 T A 1: 44,008,048 (GRCm39) D417E probably damaging Het
Tpr G A 1: 150,315,007 (GRCm39) E2025K possibly damaging Het
Trappc3 C T 4: 126,168,945 (GRCm39) A145V possibly damaging Het
Ttn T C 2: 76,721,325 (GRCm39) D6754G probably null Het
Unc13c T A 9: 73,536,473 (GRCm39) M1627L probably benign Het
Ush2a A G 1: 188,542,414 (GRCm39) I3327V probably benign Het
Vmn1r74 C T 7: 11,580,894 (GRCm39) Q65* probably null Het
Wdr18 G A 10: 79,796,202 (GRCm39) R69H probably damaging Het
Zbed5 G T 5: 129,929,279 (GRCm39) D132Y probably damaging Het
Zfp644 A T 5: 106,785,448 (GRCm39) Y366* probably null Het
Zfyve26 T C 12: 79,292,945 (GRCm39) N2068S probably damaging Het
Zic2 T C 14: 122,713,503 (GRCm39) F139S probably damaging Het
Zmynd11 T C 13: 9,760,198 (GRCm39) Q141R probably benign Het
Zrsr2-ps1 A G 11: 22,923,388 (GRCm39) E54G probably benign Het
Zscan10 G A 17: 23,828,456 (GRCm39) D333N probably benign Het
Other mutations in Fam171b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam171b APN 2 83,707,072 (GRCm39) nonsense probably null
IGL01309:Fam171b APN 2 83,709,791 (GRCm39) nonsense probably null
IGL01515:Fam171b APN 2 83,710,577 (GRCm39) missense probably damaging 0.99
IGL01604:Fam171b APN 2 83,709,944 (GRCm39) missense possibly damaging 0.50
IGL01729:Fam171b APN 2 83,685,881 (GRCm39) splice site probably benign
IGL01784:Fam171b APN 2 83,710,031 (GRCm39) missense possibly damaging 0.83
P0028:Fam171b UTSW 2 83,683,783 (GRCm39) missense probably damaging 1.00
R1203:Fam171b UTSW 2 83,643,313 (GRCm39) missense probably benign 0.05
R1530:Fam171b UTSW 2 83,710,533 (GRCm39) missense probably damaging 1.00
R1539:Fam171b UTSW 2 83,710,442 (GRCm39) missense probably benign 0.00
R1564:Fam171b UTSW 2 83,710,628 (GRCm39) missense probably damaging 1.00
R1858:Fam171b UTSW 2 83,683,725 (GRCm39) missense probably benign
R1940:Fam171b UTSW 2 83,643,218 (GRCm39) small deletion probably benign
R2131:Fam171b UTSW 2 83,710,202 (GRCm39) missense probably damaging 0.97
R3746:Fam171b UTSW 2 83,709,944 (GRCm39) missense probably damaging 1.00
R3777:Fam171b UTSW 2 83,708,605 (GRCm39) missense probably benign 0.03
R3840:Fam171b UTSW 2 83,710,406 (GRCm39) missense possibly damaging 0.76
R4920:Fam171b UTSW 2 83,710,703 (GRCm39) missense possibly damaging 0.73
R5007:Fam171b UTSW 2 83,685,853 (GRCm39) nonsense probably null
R5178:Fam171b UTSW 2 83,710,331 (GRCm39) missense probably damaging 1.00
R5282:Fam171b UTSW 2 83,683,949 (GRCm39) critical splice donor site probably null
R5544:Fam171b UTSW 2 83,685,871 (GRCm39) missense possibly damaging 0.58
R5614:Fam171b UTSW 2 83,643,217 (GRCm39) missense probably damaging 0.99
R5786:Fam171b UTSW 2 83,708,580 (GRCm39) missense probably benign 0.38
R6190:Fam171b UTSW 2 83,707,042 (GRCm39) missense probably benign
R6247:Fam171b UTSW 2 83,709,552 (GRCm39) missense probably damaging 1.00
R6309:Fam171b UTSW 2 83,690,804 (GRCm39) missense probably damaging 0.99
R6324:Fam171b UTSW 2 83,709,608 (GRCm39) nonsense probably null
R7127:Fam171b UTSW 2 83,710,110 (GRCm39) missense probably benign 0.25
R7201:Fam171b UTSW 2 83,708,574 (GRCm39) missense probably damaging 1.00
R7689:Fam171b UTSW 2 83,709,732 (GRCm39) missense probably benign 0.38
R7904:Fam171b UTSW 2 83,683,849 (GRCm39) missense probably damaging 0.97
R8069:Fam171b UTSW 2 83,643,218 (GRCm39) small deletion probably benign
R8236:Fam171b UTSW 2 83,710,550 (GRCm39) missense probably damaging 0.97
R8252:Fam171b UTSW 2 83,708,586 (GRCm39) missense probably benign 0.00
R8458:Fam171b UTSW 2 83,690,864 (GRCm39) missense probably benign 0.21
R8463:Fam171b UTSW 2 83,683,801 (GRCm39) missense probably damaging 1.00
R8546:Fam171b UTSW 2 83,685,795 (GRCm39) missense probably damaging 1.00
R8706:Fam171b UTSW 2 83,690,864 (GRCm39) missense probably benign 0.21
R8792:Fam171b UTSW 2 83,643,103 (GRCm39) missense probably damaging 1.00
R9187:Fam171b UTSW 2 83,710,365 (GRCm39) missense probably damaging 1.00
R9225:Fam171b UTSW 2 83,710,386 (GRCm39) missense probably damaging 1.00
R9266:Fam171b UTSW 2 83,683,926 (GRCm39) missense probably damaging 1.00
R9353:Fam171b UTSW 2 83,707,028 (GRCm39) missense probably benign 0.13
R9532:Fam171b UTSW 2 83,710,212 (GRCm39) missense probably damaging 1.00
R9549:Fam171b UTSW 2 83,643,199 (GRCm39) missense probably damaging 0.99
R9621:Fam171b UTSW 2 83,643,109 (GRCm39) missense probably damaging 1.00
R9625:Fam171b UTSW 2 83,683,914 (GRCm39) missense probably damaging 1.00
R9784:Fam171b UTSW 2 83,690,787 (GRCm39) missense probably damaging 0.99
RF001:Fam171b UTSW 2 83,643,230 (GRCm39) small insertion probably benign
RF009:Fam171b UTSW 2 83,643,224 (GRCm39) small insertion probably benign
RF011:Fam171b UTSW 2 83,643,239 (GRCm39) small insertion probably benign
RF011:Fam171b UTSW 2 83,643,217 (GRCm39) small insertion probably benign
RF013:Fam171b UTSW 2 83,643,239 (GRCm39) small insertion probably benign
RF027:Fam171b UTSW 2 83,643,220 (GRCm39) small insertion probably benign
RF029:Fam171b UTSW 2 83,643,236 (GRCm39) small insertion probably benign
RF036:Fam171b UTSW 2 83,643,236 (GRCm39) small insertion probably benign
RF055:Fam171b UTSW 2 83,643,220 (GRCm39) small insertion probably benign
RF056:Fam171b UTSW 2 83,643,240 (GRCm39) small insertion probably benign
RF060:Fam171b UTSW 2 83,643,221 (GRCm39) small insertion probably benign
RF063:Fam171b UTSW 2 83,643,240 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACACGTACTCAGTCTGTCTCATC -3'
(R):5'- TCATGTGTATATATGTGCATGTCTGA -3'

Sequencing Primer
(F):5'- TGTCTCATCCAGGGTGAAAC -3'
(R):5'- ATTGCAGCTTCCGTAAGAGC -3'
Posted On 2019-06-26