Incidental Mutation 'R0575:Spa17'
ID56192
Institutional Source Beutler Lab
Gene Symbol Spa17
Ensembl Gene ENSMUSG00000001948
Gene Namesperm autoantigenic protein 17
SynonymsSp17, band 34
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0575 (G1)
Quality Score129
Status Validated
Chromosome9
Chromosomal Location37603290-37613722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37603393 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 133 (K133E)
Ref Sequence ENSEMBL: ENSMUSP00000002013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002013] [ENSMUST00000213126] [ENSMUST00000214786]
Predicted Effect probably damaging
Transcript: ENSMUST00000002013
AA Change: K133E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002013
Gene: ENSMUSG00000001948
AA Change: K133E

DomainStartEndE-ValueType
RIIa 14 51 7.04e-15 SMART
low complexity region 75 86 N/A INTRINSIC
IQ 111 133 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213126
Predicted Effect probably benign
Transcript: ENSMUST00000214786
Meta Mutation Damage Score 0.1481 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein present at the cell surface. The N-terminus has sequence similarity to human cAMP-dependent protein kinase A (PKA) type II alpha regulatory subunit (RIIa) while the C-terminus has an IQ calmodulin-binding motif. The central portion of the protein has carbohydrate binding motifs and likely functions in cell-cell adhesion. The protein was initially characterized by its involvement in the binding of sperm to the zona pellucida of the oocyte. Recent studies indicate that it is also involved in additional cell-cell adhesion functions such as immune cell migration and metastasis. A retrotransposed pseudogene is present on chromosome 10q22.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Spa17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3789:Spa17 UTSW 9 37611845 missense possibly damaging 0.89
R5244:Spa17 UTSW 9 37611989 start codon destroyed probably damaging 1.00
R5503:Spa17 UTSW 9 37611977 missense probably damaging 1.00
R6612:Spa17 UTSW 9 37605794 missense probably benign 0.14
R6636:Spa17 UTSW 9 37611974 missense probably benign 0.45
R6637:Spa17 UTSW 9 37611974 missense probably benign 0.45
R7233:Spa17 UTSW 9 37603291 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTAGTCCACAACATCACGTCTCCC -3'
(R):5'- TGGCATTCAGCCCTTGGTACAC -3'

Sequencing Primer
(F):5'- ACATCACGTCTCCCTTACTGAAG -3'
(R):5'- GCCCTTGGTACACATACAGTG -3'
Posted On2013-07-11