Mutagenetix > Incidental Mutations

Incidental Mutation 'R7223:Hps3'

561926

Institutional Source

Beutler Lab

Gene Symbol

Hps3

Ensembl Gene

ENSMUSG00000027615

Gene Name

HPS3, biogenesis of lysosomal organelles complex 2 subunit 1

Synonyms

coa, cocoa

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R7223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19995945-20035315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20030419 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 202 (S202T)

Ref Sequence

ENSEMBL: ENSMUSP00000012580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000012580] [ENSMUST00000108321]

Predicted Effect

probably benign
Transcript: ENSMUST00000012580
AA Change: S202T

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: S202T

Domain	Start	End	E-Value	Type
Pfam:HPS3_N	3	212	2.8e-74	PFAM
Pfam:HPS3_Mid	255	640	1.3e-167	PFAM
Pfam:HPS3_C	649	1000	1.8e-175	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108321

SMART Domains

Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615

Domain	Start	End	E-Value	Type
Pfam:HPS3_N	3	87	5.6e-25	PFAM
Pfam:HPS3_Mid	121	508	4.2e-161	PFAM
Pfam:HPS3_C	517	870	9.2e-199	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,274,143	V733E	probably benign	Het
Adam34	A	T	8: 43,652,004	N201K	probably benign	Het
Aldh3b2	A	C	19: 3,979,592	S322R	probably damaging	Het
Anpep	A	T	7: 79,825,310	L914Q	probably damaging	Het
Arhgap30	T	C	1: 171,407,571	F535S	probably damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Baz2a	G	T	10: 128,112,606	G252V	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Carmil3	T	C	14: 55,496,238	F359S	possibly damaging	Het
Ccdc124	A	T	8: 70,868,526	L190Q	probably damaging	Het
Ccr6	T	C	17: 8,256,140	V59A	probably damaging	Het
Ccr8	T	A	9: 120,094,617	I266N	probably damaging	Het
Cdh23	T	A	10: 60,331,817	E1798V	probably damaging	Het
Cdk5rap2	T	C	4: 70,235,447	N1713S	probably benign	Het
Cep19	T	A	16: 32,104,015	I33N	probably damaging	Het
Cers3	A	T	7: 66,783,415	Y196F	probably damaging	Het
Cidea	T	C	18: 67,366,421	I126T	probably damaging	Het
Copg2	A	T	6: 30,812,754	Y546*	probably null	Het
Cul3	A	T	1: 80,287,000	V261E	probably benign	Het
Cyp2g1	A	T	7: 26,814,632	D221V	probably damaging	Het
Cyp8b1	G	A	9: 121,915,097	H390Y	probably damaging	Het
Daam1	T	C	12: 71,988,943	F971L	probably damaging	Het
Dnajc24	G	A	2: 106,001,966	S24L	possibly damaging	Het
Dpysl3	T	C	18: 43,438,042	S56G	probably benign	Het
Esp1	A	G	17: 40,731,081	D88G	probably benign	Het
Fam171b	A	G	2: 83,878,230	T359A	probably damaging	Het
Fam186b	T	C	15: 99,279,837	E536G	possibly damaging	Het
Fbxo3	T	C	2: 104,043,012	V156A	possibly damaging	Het
Gls2	C	A	10: 128,199,194	H65Q	probably benign	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpcpd1	T	A	2: 132,534,056	K435I	probably benign	Het
Gpx6	T	A	13: 21,317,670		probably null	Het
Htr1d	T	A	4: 136,443,501	L347H	probably damaging	Het
Igfals	T	C	17: 24,881,234	L433P	probably damaging	Het
Ilvbl	C	T	10: 78,583,696	H537Y	probably benign	Het
Iqgap2	A	T	13: 95,628,972	M1530K	probably damaging	Het
Jarid2	A	G	13: 44,896,322	T247A	possibly damaging	Het
L3hypdh	C	T	12: 72,074,009	V323I	possibly damaging	Het
Lama3	C	T	18: 12,582,608	T1707I	possibly damaging	Het
Map6	G	T	7: 99,268,025	A2S	probably damaging	Het
Mfap3	T	A	11: 57,530,240	I349K	probably benign	Het
Mybl2	A	G	2: 163,072,705	T248A	probably benign	Het
N6amt1	A	G	16: 87,362,660	*151W	probably null	Het
Nhlrc1	A	G	13: 47,014,208	V191A	probably benign	Het
Nkx2-5	T	C	17: 26,839,620	E120G	possibly damaging	Het
Olfr1066	T	A	2: 86,455,867	I135F	possibly damaging	Het
Olfr1380	T	A	11: 49,564,098	M59K	probably damaging	Het
Olfr582	C	A	7: 103,041,632	T46N	possibly damaging	Het
Olfr890	T	C	9: 38,143,753	V201A	probably benign	Het
Pcdha8	T	G	18: 36,993,148	L228V	probably benign	Het
Pcsk2	A	G	2: 143,690,333	T134A	possibly damaging	Het
Phldb3	G	A	7: 24,624,653	R484Q	probably benign	Het
Pipox	A	G	11: 77,881,186	S371P	probably damaging	Het
Plekhg1	T	C	10: 3,873,343	S159P		Het
Psme4	C	T	11: 30,874,226	P1737S	probably benign	Het
Pygm	G	A	19: 6,388,863	D328N	probably benign	Het
Rabgef1	A	T	5: 130,190,960	E88V	probably benign	Het
Rims2	G	T	15: 39,437,032	R245L	probably benign	Het
Slc38a4	T	C	15: 97,010,345	I172V	probably damaging	Het
Slc4a10	T	A	2: 62,268,665	Y586N	probably damaging	Het
Snap91	C	T	9: 86,879,557		probably benign	Het
Sorcs1	C	T	19: 50,190,042	V881I	probably benign	Het
Spef2	A	T	15: 9,601,640	V1512E	unknown	Het
Sufu	T	C	19: 46,453,277	I292T	possibly damaging	Het
Tet1	T	C	10: 62,813,671	N87D	possibly damaging	Het
Tmem108	T	C	9: 103,499,534	T239A	not run	Het
Tmem121	A	T	12: 113,188,494	K111*	probably null	Het
Tpp2	T	A	1: 43,968,888	D417E	probably damaging	Het
Tpr	G	A	1: 150,439,256	E2025K	possibly damaging	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Ttn	T	C	2: 76,890,981	D6754G	probably null	Het
Unc13c	T	A	9: 73,629,191	M1627L	probably benign	Het
Ush2a	A	G	1: 188,810,217	I3327V	probably benign	Het
Vmn1r74	C	T	7: 11,846,967	Q65*	probably null	Het
Wdr18	G	A	10: 79,960,368	R69H	probably damaging	Het
Zbed5	G	T	5: 129,900,438	D132Y	probably damaging	Het
Zfp644	A	T	5: 106,637,582	Y366*	probably null	Het
Zfyve26	T	C	12: 79,246,171	N2068S	probably damaging	Het
Zic2	T	C	14: 122,476,091	F139S	probably damaging	Het
Zmynd11	T	C	13: 9,710,162	Q141R	probably benign	Het
Zrsr1	A	G	11: 22,973,388	E54G	probably benign	Het
Zscan10	G	A	17: 23,609,482	D333N	probably benign	Het

Other mutations in Hps3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00545:Hps3	APN	3	20019807	missense	possibly damaging	0.94
IGL00846:Hps3	APN	3	20025792	missense	probably benign	0.00
IGL01320:Hps3	APN	3	20030469	missense	probably benign	0.12
IGL01364:Hps3	APN	3	20003305	missense	possibly damaging	0.58
IGL01751:Hps3	APN	3	20010966	missense	probably damaging	1.00
IGL01843:Hps3	APN	3	20029001	missense	probably benign	0.05
IGL02294:Hps3	APN	3	20014048	missense	probably damaging	1.00
IGL02581:Hps3	APN	3	20003221	intron	probably benign
Blue	UTSW	3	20030796	missense	probably damaging	1.00
earl_grey	UTSW	3	20017173	intron	probably benign
gandalf	UTSW	3	20012796	nonsense	probably null
pam_gray	UTSW	3	20017173	intron	probably benign
R0107:Hps3	UTSW	3	20030796	missense	probably damaging	1.00
R0245:Hps3	UTSW	3	20012796	nonsense	probably null
R0421:Hps3	UTSW	3	20029316	missense	probably benign	0.00
R0524:Hps3	UTSW	3	20012776	missense	probably damaging	1.00
R0763:Hps3	UTSW	3	20003279	missense	probably damaging	1.00
R1795:Hps3	UTSW	3	20012695	critical splice donor site	probably null
R1864:Hps3	UTSW	3	20019959	critical splice acceptor site	probably null
R2029:Hps3	UTSW	3	20030527	missense	probably benign	0.01
R2101:Hps3	UTSW	3	20012783	missense	possibly damaging	0.95
R2221:Hps3	UTSW	3	20002363	missense	probably benign
R2268:Hps3	UTSW	3	20012935	splice site	probably benign
R2520:Hps3	UTSW	3	20029030	missense	probably damaging	1.00
R3809:Hps3	UTSW	3	20018812	missense	probably damaging	1.00
R3888:Hps3	UTSW	3	20003223	critical splice donor site	probably null
R3942:Hps3	UTSW	3	19996939	missense	probably damaging	1.00
R4022:Hps3	UTSW	3	20035261	missense	possibly damaging	0.69
R4156:Hps3	UTSW	3	20029229	missense	probably damaging	1.00
R4739:Hps3	UTSW	3	20030410	critical splice acceptor site	probably null
R4823:Hps3	UTSW	3	20012726	missense	probably benign	0.03
R4912:Hps3	UTSW	3	20014173	missense	probably damaging	1.00
R5307:Hps3	UTSW	3	20012701	missense	possibly damaging	0.89
R5859:Hps3	UTSW	3	20008870	missense	probably benign	0.02
R6140:Hps3	UTSW	3	19996987	missense	probably damaging	1.00
R6183:Hps3	UTSW	3	20008868	missense	probably benign	0.04
R6971:Hps3	UTSW	3	20011535	missense	probably damaging	1.00
R6981:Hps3	UTSW	3	20022820	missense	probably damaging	1.00
R7120:Hps3	UTSW	3	20011541	missense	probably damaging	1.00
R7146:Hps3	UTSW	3	20008886	missense	probably damaging	1.00
R7448:Hps3	UTSW	3	20035165	missense	probably damaging	0.99
R7452:Hps3	UTSW	3	20011428	missense	probably damaging	1.00
R7560:Hps3	UTSW	3	20030452	missense	probably benign	0.29
R7659:Hps3	UTSW	3	20022814	nonsense	probably null
X0021:Hps3	UTSW	3	20030749	missense	probably benign	0.14
X0066:Hps3	UTSW	3	20015988	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCATGCCACTATAGATACCAGG -3'
(R):5'- TGAGATGCCAATGTCTGAGGC -3'

Sequencing Primer
(F):5'- TCCGCCTCTTTCAATGGA -3'
(R):5'- AATGTCTGAGGCCCCTTTG -3'

Posted On

2019-06-26