Incidental Mutation 'R7223:Zfp644'
ID561930
Institutional Source Beutler Lab
Gene Symbol Zfp644
Ensembl Gene ENSMUSG00000049606
Gene Namezinc finger protein 644
SynonymsD5Ertd689e, 1110068L01Rik, Zep-2, BM-005
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location106616739-106697287 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 106637582 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 366 (Y366*)
Ref Sequence ENSEMBL: ENSMUSP00000038047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045466] [ENSMUST00000112695] [ENSMUST00000112696] [ENSMUST00000112698] [ENSMUST00000122980] [ENSMUST00000124263] [ENSMUST00000127434] [ENSMUST00000135108] [ENSMUST00000137285] [ENSMUST00000155495]
Predicted Effect probably null
Transcript: ENSMUST00000045466
AA Change: Y366*
SMART Domains Protein: ENSMUSP00000038047
Gene: ENSMUSG00000049606
AA Change: Y366*

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112695
SMART Domains Protein: ENSMUSP00000108315
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Blast:ZnF_C2H2 39 65 2e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112696
AA Change: Y366*
SMART Domains Protein: ENSMUSP00000108316
Gene: ENSMUSG00000049606
AA Change: Y366*

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 767 783 N/A INTRINSIC
low complexity region 802 819 N/A INTRINSIC
ZnF_C2H2 959 981 1.07e0 SMART
ZnF_C2H2 1034 1056 1.43e-1 SMART
low complexity region 1230 1243 N/A INTRINSIC
ZnF_C2H2 1257 1283 5.4e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112698
AA Change: Y366*
SMART Domains Protein: ENSMUSP00000108318
Gene: ENSMUSG00000049606
AA Change: Y366*

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122980
Predicted Effect probably benign
Transcript: ENSMUST00000124263
Predicted Effect probably null
Transcript: ENSMUST00000127434
AA Change: Y366*
SMART Domains Protein: ENSMUSP00000122421
Gene: ENSMUSG00000049606
AA Change: Y366*

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135108
Predicted Effect probably benign
Transcript: ENSMUST00000137285
Predicted Effect probably benign
Transcript: ENSMUST00000155495
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Zfp644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Zfp644 APN 5 106638637 critical splice acceptor site probably null
IGL01654:Zfp644 APN 5 106635930 missense probably damaging 1.00
IGL01967:Zfp644 APN 5 106638243 missense probably damaging 1.00
IGL02132:Zfp644 APN 5 106635894 missense probably benign 0.22
IGL02164:Zfp644 APN 5 106638099 missense probably benign 0.01
IGL02303:Zfp644 APN 5 106637314 missense probably damaging 1.00
IGL03091:Zfp644 APN 5 106636858 missense probably damaging 1.00
IGL03102:Zfp644 APN 5 106637268 missense probably damaging 0.99
IGL03298:Zfp644 APN 5 106635101 missense possibly damaging 0.93
PIT4466001:Zfp644 UTSW 5 106636477 missense probably damaging 0.99
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0178:Zfp644 UTSW 5 106636905 missense probably damaging 1.00
R0497:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1302:Zfp644 UTSW 5 106634899 missense probably damaging 1.00
R1337:Zfp644 UTSW 5 106637554 missense probably damaging 0.99
R1400:Zfp644 UTSW 5 106637470 unclassified probably null
R1597:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1911:Zfp644 UTSW 5 106635271 missense possibly damaging 0.95
R2021:Zfp644 UTSW 5 106635682 missense possibly damaging 0.84
R2196:Zfp644 UTSW 5 106638603 start codon destroyed probably null 0.02
R2256:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R2311:Zfp644 UTSW 5 106634956 missense probably benign 0.21
R2420:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2421:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2422:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R3752:Zfp644 UTSW 5 106636383 missense probably benign
R4207:Zfp644 UTSW 5 106618276 missense probably damaging 1.00
R4285:Zfp644 UTSW 5 106635118 missense probably damaging 1.00
R4874:Zfp644 UTSW 5 106635413 missense probably damaging 1.00
R4961:Zfp644 UTSW 5 106618215 utr 3 prime probably benign
R4984:Zfp644 UTSW 5 106636917 missense possibly damaging 0.96
R5007:Zfp644 UTSW 5 106636001 missense probably benign
R5358:Zfp644 UTSW 5 106635675 missense probably damaging 1.00
R5382:Zfp644 UTSW 5 106634869 missense possibly damaging 0.88
R5416:Zfp644 UTSW 5 106618428 splice site silent
R5641:Zfp644 UTSW 5 106619595 missense probably damaging 1.00
R5656:Zfp644 UTSW 5 106637982 missense probably benign 0.12
R5732:Zfp644 UTSW 5 106637123 missense probably damaging 1.00
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6306:Zfp644 UTSW 5 106638124 missense probably damaging 0.99
R6317:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R6354:Zfp644 UTSW 5 106636753 missense probably benign 0.23
R6886:Zfp644 UTSW 5 106637911 missense possibly damaging 0.53
R7326:Zfp644 UTSW 5 106638277 missense probably benign 0.12
R7450:Zfp644 UTSW 5 106638526 missense probably benign 0.00
X0011:Zfp644 UTSW 5 106618427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCATATGCCTGTGGAGATG -3'
(R):5'- TGAGCAAGATCACTCGCTACAC -3'

Sequencing Primer
(F):5'- CATATGCCTGTGGAGATGCTTTTTC -3'
(R):5'- CAGAGGACTGCTACAGTGACTC -3'
Posted On2019-06-26