Incidental Mutation 'R7223:Rabgef1'
ID561932
Institutional Source Beutler Lab
Gene Symbol Rabgef1
Ensembl Gene ENSMUSG00000025340
Gene NameRAB guanine nucleotide exchange factor (GEF) 1
SynonymsRas negative regulator Rabex-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location130171798-130214342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130190960 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 88 (E88V)
Ref Sequence ENSEMBL: ENSMUSP00000026390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026390] [ENSMUST00000119027] [ENSMUST00000119797] [ENSMUST00000148264]
Predicted Effect probably benign
Transcript: ENSMUST00000026390
AA Change: E88V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026390
Gene: ENSMUSG00000025340
AA Change: E88V

DomainStartEndE-ValueType
ZnF_A20 16 40 1.5e-12 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
VPS9 262 383 1.8e-29 SMART
coiled coil region 411 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119027
AA Change: E88V

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112537
Gene: ENSMUSG00000025340
AA Change: E88V

DomainStartEndE-ValueType
ZnF_A20 16 40 2.35e-10 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
PDB:1TXU|A 132 221 7e-51 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000119797
AA Change: E88V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114103
Gene: ENSMUSG00000025340
AA Change: E88V

DomainStartEndE-ValueType
ZnF_A20 16 40 1.4e-12 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
VPS9 262 383 1.8e-29 SMART
coiled coil region 411 445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148264
AA Change: E88V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119245
Gene: ENSMUSG00000025340
AA Change: E88V

DomainStartEndE-ValueType
ZnF_A20 16 40 2.35e-10 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
PDB:1TXU|A 132 250 1e-72 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RABGEF1 forms a complex with rabaptin-5 (RABPT5; MIM 603616) that is required for endocytic membrane fusion, and it serves as a specific guanine nucleotide exchange factor (GEF) for RAB5 (RAB5A; MIM 179512) (Horiuchi et al., 1997 [PubMed 9323142]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Nullizygous mutations can cause neonatal or postnatal lethality associated with severe skin inflammation, high mast cell numbers and serum levels of IgE and histamine, and enhanced mast cell degranulation and release of mediators and cytokines in response to high affinity IgE receptor aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Rabgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Rabgef1 APN 5 130208724 nonsense probably null
IGL00964:Rabgef1 APN 5 130191022 missense probably damaging 1.00
IGL01830:Rabgef1 APN 5 130212066 missense possibly damaging 0.88
IGL02161:Rabgef1 APN 5 130207099 splice site probably benign
IGL02231:Rabgef1 APN 5 130211975 missense probably damaging 1.00
IGL02429:Rabgef1 APN 5 130210488 missense possibly damaging 0.48
IGL02620:Rabgef1 APN 5 130191022 missense probably damaging 1.00
IGL03005:Rabgef1 APN 5 130208797 missense probably damaging 1.00
LCD18:Rabgef1 UTSW 5 130187586 frame shift probably null
R0227:Rabgef1 UTSW 5 130190990 missense probably damaging 1.00
R1028:Rabgef1 UTSW 5 130212862 nonsense probably null
R1838:Rabgef1 UTSW 5 130213021 missense probably benign 0.01
R2027:Rabgef1 UTSW 5 130208779 missense possibly damaging 0.69
R2074:Rabgef1 UTSW 5 130187561 missense probably benign 0.21
R2079:Rabgef1 UTSW 5 130190935 missense probably damaging 0.99
R2355:Rabgef1 UTSW 5 130212087 missense probably benign 0.29
R3625:Rabgef1 UTSW 5 130212120 critical splice donor site probably null
R3892:Rabgef1 UTSW 5 130208679 splice site probably benign
R5060:Rabgef1 UTSW 5 130212003 missense probably damaging 1.00
R5249:Rabgef1 UTSW 5 130213000 missense probably benign 0.00
R6597:Rabgef1 UTSW 5 130191044 critical splice donor site probably null
R7326:Rabgef1 UTSW 5 130187351 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAGATCTCAGACCCACTTGG -3'
(R):5'- TCTCTTGGGCTTACAGAAGTGAGAG -3'

Sequencing Primer
(F):5'- AGAGGACCCAGATCATTC -3'
(R):5'- CTTACAGAAGTGAGAGGCTGAGC -3'
Posted On2019-06-26