Incidental Mutation 'R7223:Adam34'
ID 561942
Institutional Source Beutler Lab
Gene Symbol Adam34
Ensembl Gene ENSMUSG00000079058
Gene Name a disintegrin and metallopeptidase domain 34
Synonyms testase 4
MMRRC Submission 045295-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 44103346-44118597 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 44105041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 201 (N201K)
Ref Sequence ENSEMBL: ENSMUSP00000148332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110411] [ENSMUST00000212185]
AlphaFold A2RSG8
Predicted Effect probably benign
Transcript: ENSMUST00000110411
AA Change: N201K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106041
Gene: ENSMUSG00000079058
AA Change: N201K

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 159 5.9e-20 PFAM
Pfam:Reprolysin_5 205 377 1.6e-16 PFAM
Pfam:Reprolysin_4 205 393 3e-12 PFAM
Pfam:Reprolysin 207 397 9.4e-49 PFAM
Pfam:Reprolysin_2 224 389 1e-14 PFAM
Pfam:Reprolysin_3 231 352 2.7e-14 PFAM
DISIN 416 491 3.38e-40 SMART
ACR 492 628 9.18e-62 SMART
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212185
AA Change: N201K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,104,487 (GRCm39) V733E probably benign Het
Aldh3b2 A C 19: 4,029,592 (GRCm39) S322R probably damaging Het
Anpep A T 7: 79,475,058 (GRCm39) L914Q probably damaging Het
Arhgap30 T C 1: 171,235,139 (GRCm39) F535S probably damaging Het
Baiap3 G A 17: 25,462,814 (GRCm39) R1075C probably benign Het
Baz2a G T 10: 127,948,475 (GRCm39) G252V probably damaging Het
Brinp3 T A 1: 146,776,812 (GRCm39) S420T possibly damaging Het
Carmil3 T C 14: 55,733,695 (GRCm39) F359S possibly damaging Het
Ccdc124 A T 8: 71,321,170 (GRCm39) L190Q probably damaging Het
Ccr6 T C 17: 8,474,972 (GRCm39) V59A probably damaging Het
Ccr8 T A 9: 119,923,683 (GRCm39) I266N probably damaging Het
Cdh23 T A 10: 60,167,596 (GRCm39) E1798V probably damaging Het
Cdk5rap2 T C 4: 70,153,684 (GRCm39) N1713S probably benign Het
Cep19 T A 16: 31,922,833 (GRCm39) I33N probably damaging Het
Cers3 A T 7: 66,433,163 (GRCm39) Y196F probably damaging Het
Cidea T C 18: 67,499,491 (GRCm39) I126T probably damaging Het
Copg2 A T 6: 30,789,689 (GRCm39) Y546* probably null Het
Cul3 A T 1: 80,264,717 (GRCm39) V261E probably benign Het
Cyp2g1 A T 7: 26,514,057 (GRCm39) D221V probably damaging Het
Cyp8b1 G A 9: 121,744,163 (GRCm39) H390Y probably damaging Het
Daam1 T C 12: 72,035,717 (GRCm39) F971L probably damaging Het
Dnajc24 G A 2: 105,832,311 (GRCm39) S24L possibly damaging Het
Dpysl3 T C 18: 43,571,107 (GRCm39) S56G probably benign Het
Esp1 A G 17: 41,041,972 (GRCm39) D88G probably benign Het
Fam171b A G 2: 83,708,574 (GRCm39) T359A probably damaging Het
Fam186b T C 15: 99,177,718 (GRCm39) E536G possibly damaging Het
Fbxo3 T C 2: 103,873,357 (GRCm39) V156A possibly damaging Het
Gls2 C A 10: 128,035,063 (GRCm39) H65Q probably benign Het
Gp2 A G 7: 119,050,721 (GRCm39) probably null Het
Gpcpd1 T A 2: 132,375,976 (GRCm39) K435I probably benign Het
Gpx6 T A 13: 21,501,840 (GRCm39) probably null Het
Hps3 A T 3: 20,084,583 (GRCm39) S202T probably benign Het
Htr1d T A 4: 136,170,812 (GRCm39) L347H probably damaging Het
Igfals T C 17: 25,100,208 (GRCm39) L433P probably damaging Het
Ilvbl C T 10: 78,419,530 (GRCm39) H537Y probably benign Het
Iqgap2 A T 13: 95,765,480 (GRCm39) M1530K probably damaging Het
Jarid2 A G 13: 45,049,798 (GRCm39) T247A possibly damaging Het
L3hypdh C T 12: 72,120,783 (GRCm39) V323I possibly damaging Het
Lama3 C T 18: 12,715,665 (GRCm39) T1707I possibly damaging Het
Map6 G T 7: 98,917,232 (GRCm39) A2S probably damaging Het
Mfap3 T A 11: 57,421,066 (GRCm39) I349K probably benign Het
Mybl2 A G 2: 162,914,625 (GRCm39) T248A probably benign Het
N6amt1 A G 16: 87,159,548 (GRCm39) *151W probably null Het
Nhlrc1 A G 13: 47,167,684 (GRCm39) V191A probably benign Het
Nkx2-5 T C 17: 27,058,594 (GRCm39) E120G possibly damaging Het
Or2y10 T A 11: 49,454,925 (GRCm39) M59K probably damaging Het
Or52r1b C A 7: 102,690,839 (GRCm39) T46N possibly damaging Het
Or8b41 T C 9: 38,055,049 (GRCm39) V201A probably benign Het
Or8k28 T A 2: 86,286,211 (GRCm39) I135F possibly damaging Het
Pcdha8 T G 18: 37,126,201 (GRCm39) L228V probably benign Het
Pcsk2 A G 2: 143,532,253 (GRCm39) T134A possibly damaging Het
Phldb3 G A 7: 24,324,078 (GRCm39) R484Q probably benign Het
Pipox A G 11: 77,772,012 (GRCm39) S371P probably damaging Het
Plekhg1 T C 10: 3,823,343 (GRCm39) S159P Het
Psme4 C T 11: 30,824,226 (GRCm39) P1737S probably benign Het
Pygm G A 19: 6,438,893 (GRCm39) D328N probably benign Het
Rabgef1 A T 5: 130,219,801 (GRCm39) E88V probably benign Het
Rims2 G T 15: 39,300,428 (GRCm39) R245L probably benign Het
Slc38a4 T C 15: 96,908,226 (GRCm39) I172V probably damaging Het
Slc4a10 T A 2: 62,099,009 (GRCm39) Y586N probably damaging Het
Snap91 C T 9: 86,761,610 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,178,480 (GRCm39) V881I probably benign Het
Spef2 A T 15: 9,601,726 (GRCm39) V1512E unknown Het
Sufu T C 19: 46,441,716 (GRCm39) I292T possibly damaging Het
Tet1 T C 10: 62,649,450 (GRCm39) N87D possibly damaging Het
Tmem108 T C 9: 103,376,733 (GRCm39) T239A not run Het
Tmem121 A T 12: 113,152,114 (GRCm39) K111* probably null Het
Tpp2 T A 1: 44,008,048 (GRCm39) D417E probably damaging Het
Tpr G A 1: 150,315,007 (GRCm39) E2025K possibly damaging Het
Trappc3 C T 4: 126,168,945 (GRCm39) A145V possibly damaging Het
Ttn T C 2: 76,721,325 (GRCm39) D6754G probably null Het
Unc13c T A 9: 73,536,473 (GRCm39) M1627L probably benign Het
Ush2a A G 1: 188,542,414 (GRCm39) I3327V probably benign Het
Vmn1r74 C T 7: 11,580,894 (GRCm39) Q65* probably null Het
Wdr18 G A 10: 79,796,202 (GRCm39) R69H probably damaging Het
Zbed5 G T 5: 129,929,279 (GRCm39) D132Y probably damaging Het
Zfp644 A T 5: 106,785,448 (GRCm39) Y366* probably null Het
Zfyve26 T C 12: 79,292,945 (GRCm39) N2068S probably damaging Het
Zic2 T C 14: 122,713,503 (GRCm39) F139S probably damaging Het
Zmynd11 T C 13: 9,760,198 (GRCm39) Q141R probably benign Het
Zrsr2-ps1 A G 11: 22,923,388 (GRCm39) E54G probably benign Het
Zscan10 G A 17: 23,828,456 (GRCm39) D333N probably benign Het
Other mutations in Adam34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Adam34 APN 8 44,105,227 (GRCm39) missense possibly damaging 0.91
IGL01296:Adam34 APN 8 44,104,178 (GRCm39) missense possibly damaging 0.90
IGL01369:Adam34 APN 8 44,104,094 (GRCm39) missense probably benign 0.00
IGL01933:Adam34 APN 8 44,104,569 (GRCm39) missense probably damaging 1.00
IGL01938:Adam34 APN 8 44,104,053 (GRCm39) missense probably damaging 1.00
IGL02112:Adam34 APN 8 44,104,175 (GRCm39) missense possibly damaging 0.46
IGL02182:Adam34 APN 8 44,104,790 (GRCm39) missense probably benign
IGL02306:Adam34 APN 8 44,103,522 (GRCm39) missense probably benign 0.44
IGL02661:Adam34 APN 8 44,104,572 (GRCm39) missense probably damaging 1.00
IGL02888:Adam34 APN 8 44,104,610 (GRCm39) missense probably damaging 1.00
IGL02979:Adam34 APN 8 44,104,408 (GRCm39) missense probably damaging 1.00
IGL03073:Adam34 APN 8 44,103,940 (GRCm39) missense probably damaging 0.99
BB010:Adam34 UTSW 8 44,103,911 (GRCm39) missense probably damaging 1.00
BB020:Adam34 UTSW 8 44,103,911 (GRCm39) missense probably damaging 1.00
PIT4453001:Adam34 UTSW 8 44,104,349 (GRCm39) missense probably damaging 1.00
R0060:Adam34 UTSW 8 44,128,920 (GRCm39) intron probably benign
R0317:Adam34 UTSW 8 44,105,288 (GRCm39) missense probably benign 0.14
R0322:Adam34 UTSW 8 44,104,958 (GRCm39) missense probably benign 0.00
R0427:Adam34 UTSW 8 44,105,493 (GRCm39) missense probably benign 0.15
R0593:Adam34 UTSW 8 44,104,724 (GRCm39) missense possibly damaging 0.87
R0837:Adam34 UTSW 8 44,104,537 (GRCm39) missense probably benign 0.00
R0927:Adam34 UTSW 8 44,104,621 (GRCm39) missense probably damaging 1.00
R1634:Adam34 UTSW 8 44,105,127 (GRCm39) missense possibly damaging 0.81
R1653:Adam34 UTSW 8 44,103,682 (GRCm39) nonsense probably null
R1826:Adam34 UTSW 8 44,104,379 (GRCm39) missense probably damaging 1.00
R1873:Adam34 UTSW 8 44,104,843 (GRCm39) missense probably benign 0.02
R1943:Adam34 UTSW 8 44,104,852 (GRCm39) missense probably damaging 1.00
R1943:Adam34 UTSW 8 44,103,864 (GRCm39) missense possibly damaging 0.48
R2147:Adam34 UTSW 8 44,105,538 (GRCm39) missense probably benign 0.01
R2150:Adam34 UTSW 8 44,105,538 (GRCm39) missense probably benign 0.01
R2206:Adam34 UTSW 8 44,105,274 (GRCm39) missense probably benign 0.02
R2207:Adam34 UTSW 8 44,105,274 (GRCm39) missense probably benign 0.02
R2268:Adam34 UTSW 8 44,103,647 (GRCm39) missense probably benign 0.00
R2349:Adam34 UTSW 8 44,105,415 (GRCm39) missense probably damaging 0.99
R3983:Adam34 UTSW 8 44,103,806 (GRCm39) missense probably benign
R4158:Adam34 UTSW 8 44,103,854 (GRCm39) missense probably damaging 1.00
R4179:Adam34 UTSW 8 44,104,128 (GRCm39) missense probably benign 0.18
R5219:Adam34 UTSW 8 44,104,461 (GRCm39) missense probably benign
R5398:Adam34 UTSW 8 44,104,278 (GRCm39) missense probably damaging 1.00
R5611:Adam34 UTSW 8 44,104,749 (GRCm39) missense probably benign 0.43
R5928:Adam34 UTSW 8 44,105,067 (GRCm39) missense probably benign 0.08
R6115:Adam34 UTSW 8 44,105,098 (GRCm39) missense probably benign
R6319:Adam34 UTSW 8 44,104,952 (GRCm39) missense probably benign 0.01
R6384:Adam34 UTSW 8 44,103,836 (GRCm39) missense probably benign 0.00
R6706:Adam34 UTSW 8 44,104,479 (GRCm39) nonsense probably null
R6992:Adam34 UTSW 8 44,105,642 (GRCm39) start codon destroyed probably null 1.00
R7032:Adam34 UTSW 8 44,105,303 (GRCm39) missense probably damaging 1.00
R7151:Adam34 UTSW 8 44,104,499 (GRCm39) missense probably benign 0.19
R7187:Adam34 UTSW 8 44,105,565 (GRCm39) missense probably benign 0.02
R7487:Adam34 UTSW 8 44,104,191 (GRCm39) missense probably damaging 1.00
R7726:Adam34 UTSW 8 44,104,208 (GRCm39) missense probably damaging 0.99
R7789:Adam34 UTSW 8 44,105,488 (GRCm39) missense probably benign 0.00
R7810:Adam34 UTSW 8 44,105,045 (GRCm39) missense probably benign 0.01
R7933:Adam34 UTSW 8 44,103,911 (GRCm39) missense probably damaging 1.00
R8192:Adam34 UTSW 8 44,103,970 (GRCm39) missense probably damaging 1.00
R8231:Adam34 UTSW 8 44,104,659 (GRCm39) missense probably benign
R8238:Adam34 UTSW 8 44,103,993 (GRCm39) missense probably damaging 1.00
R8259:Adam34 UTSW 8 44,104,646 (GRCm39) missense probably benign 0.03
R8339:Adam34 UTSW 8 44,103,640 (GRCm39) missense probably benign 0.20
R8381:Adam34 UTSW 8 44,104,847 (GRCm39) missense possibly damaging 0.70
R8670:Adam34 UTSW 8 44,105,126 (GRCm39) missense possibly damaging 0.91
R8693:Adam34 UTSW 8 44,104,641 (GRCm39) missense probably benign
R8932:Adam34 UTSW 8 44,105,192 (GRCm39) missense probably benign 0.19
R8936:Adam34 UTSW 8 44,104,439 (GRCm39) missense probably benign 0.00
R8981:Adam34 UTSW 8 44,103,840 (GRCm39) missense probably benign 0.05
R9040:Adam34 UTSW 8 44,103,363 (GRCm39) unclassified probably benign
R9105:Adam34 UTSW 8 44,103,785 (GRCm39) missense probably damaging 1.00
R9305:Adam34 UTSW 8 44,104,416 (GRCm39) missense probably damaging 1.00
R9321:Adam34 UTSW 8 44,105,243 (GRCm39) missense probably damaging 1.00
R9641:Adam34 UTSW 8 44,104,076 (GRCm39) missense probably damaging 0.97
R9644:Adam34 UTSW 8 44,104,766 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGAATGCACCTAGAACCTTTC -3'
(R):5'- ACTTATGAAATCATGCCCAAGAGC -3'

Sequencing Primer
(F):5'- AATGCACCTAGAACCTTTCTTATTTC -3'
(R):5'- CACAACGTCAACATTTGAACATCTGG -3'
Posted On 2019-06-26