Incidental Mutation 'R7223:Plekhg1'
ID561950
Institutional Source Beutler Lab
Gene Symbol Plekhg1
Ensembl Gene ENSMUSG00000040624
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 1
SynonymsD10Ertd733e
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001159942.1, NM_001033253.3; MGI:2676551

Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location3740364-3967303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3873343 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 159 (S159P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042438] [ENSMUST00000120274]
Predicted Effect probably benign
Transcript: ENSMUST00000042438
AA Change: S104P

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040495
Gene: ENSMUSG00000040624
AA Change: S104P

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120274
AA Change: S104P

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114056
Gene: ENSMUSG00000040624
AA Change: S104P

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119950
Gene: ENSMUSG00000040624
AA Change: S159P

DomainStartEndE-ValueType
low complexity region 67 86 N/A INTRINSIC
RhoGEF 172 347 4.17e-52 SMART
PH 379 473 2.54e-6 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1242 1253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(13) : Targeted(2) Gene trapped(11)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Plekhg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Plekhg1 APN 10 3963631 missense probably benign 0.02
IGL01639:Plekhg1 APN 10 3956751 missense probably damaging 0.98
IGL01766:Plekhg1 APN 10 3873400 missense probably damaging 1.00
IGL01983:Plekhg1 APN 10 3945904 missense probably damaging 1.00
IGL02226:Plekhg1 APN 10 3945916 missense probably damaging 0.99
IGL02420:Plekhg1 APN 10 3964106 missense probably damaging 1.00
IGL02441:Plekhg1 APN 10 3958103 missense possibly damaging 0.89
IGL02505:Plekhg1 APN 10 3957139 missense probably damaging 0.97
IGL02659:Plekhg1 APN 10 3957069 nonsense probably null
IGL02730:Plekhg1 APN 10 3873242 missense possibly damaging 0.59
PIT4453001:Plekhg1 UTSW 10 3963469 missense
R0041:Plekhg1 UTSW 10 3964076 nonsense probably null
R0041:Plekhg1 UTSW 10 3964074 missense probably benign 0.02
R0068:Plekhg1 UTSW 10 3940502 missense probably damaging 0.99
R0068:Plekhg1 UTSW 10 3940504 nonsense probably null
R0333:Plekhg1 UTSW 10 3964419 missense probably damaging 1.00
R0427:Plekhg1 UTSW 10 3964235 missense probably benign 0.01
R0499:Plekhg1 UTSW 10 3937971 missense probably damaging 1.00
R0504:Plekhg1 UTSW 10 3937853 missense probably damaging 1.00
R1499:Plekhg1 UTSW 10 3940538 splice site probably benign
R1501:Plekhg1 UTSW 10 3957361 missense probably benign 0.02
R1565:Plekhg1 UTSW 10 3940526 missense probably damaging 1.00
R1801:Plekhg1 UTSW 10 3963904 missense probably damaging 1.00
R1823:Plekhg1 UTSW 10 3903658 critical splice donor site probably null
R1858:Plekhg1 UTSW 10 3945917 missense possibly damaging 0.95
R1984:Plekhg1 UTSW 10 3958181 missense probably damaging 1.00
R2420:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2421:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2422:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2437:Plekhg1 UTSW 10 3963564 missense probably damaging 1.00
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R3830:Plekhg1 UTSW 10 3873400 missense probably damaging 1.00
R4058:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4059:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4649:Plekhg1 UTSW 10 3956985 missense probably benign 0.00
R4731:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4732:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4733:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4772:Plekhg1 UTSW 10 3873127 missense probably benign 0.00
R4772:Plekhg1 UTSW 10 3873130 missense probably damaging 1.00
R4803:Plekhg1 UTSW 10 3957186 missense probably benign 0.02
R5086:Plekhg1 UTSW 10 3903649 missense probably damaging 1.00
R5175:Plekhg1 UTSW 10 3965516 unclassified probably benign
R5283:Plekhg1 UTSW 10 3956654 missense probably benign 0.00
R5862:Plekhg1 UTSW 10 3937914 missense probably damaging 1.00
R6163:Plekhg1 UTSW 10 3964369 missense probably damaging 1.00
R6564:Plekhg1 UTSW 10 3964153 missense probably damaging 1.00
R6700:Plekhg1 UTSW 10 3957373 missense probably benign
R6930:Plekhg1 UTSW 10 3963770 missense possibly damaging 0.56
R7033:Plekhg1 UTSW 10 3940251 missense probably damaging 0.97
R7200:Plekhg1 UTSW 10 3956810 missense
R7353:Plekhg1 UTSW 10 3964327 missense
R7488:Plekhg1 UTSW 10 3957491 missense
R7554:Plekhg1 UTSW 10 3963647 missense
Predicted Primers PCR Primer
(F):5'- GACTTTGGTTTCAAACAGCCAC -3'
(R):5'- AAACGAAGCCCCGGGTTTTC -3'

Sequencing Primer
(F):5'- GTTTCAAACAGCCACTTGGG -3'
(R):5'- GAAGCCCCGGGTTTTCCTCTATAG -3'
Posted On2019-06-26