Incidental Mutation 'R7223:Wdr18'
ID 561954
Institutional Source Beutler Lab
Gene Symbol Wdr18
Ensembl Gene ENSMUSG00000035754
Gene Name WD repeat domain 18
Synonyms 2310012I10Rik
MMRRC Submission 045295-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R7223 (G1)
Quality Score 212.009
Status Not validated
Chromosome 10
Chromosomal Location 79795989-79805081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79796202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 69 (R69H)
Ref Sequence ENSEMBL: ENSMUSP00000041049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045247]
AlphaFold Q4VBE8
Predicted Effect probably damaging
Transcript: ENSMUST00000045247
AA Change: R69H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041049
Gene: ENSMUSG00000035754
AA Change: R69H

DomainStartEndE-ValueType
Blast:WD40 27 66 3e-17 BLAST
WD40 70 107 1.48e1 SMART
WD40 110 149 1.24e-4 SMART
WD40 161 202 2.49e-1 SMART
WD40 205 243 2.05e1 SMART
WD40 258 297 2.32e-9 SMART
low complexity region 353 367 N/A INTRINSIC
Pfam:WD40_alt 383 429 4.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(8) : Targeted(1) Gene trapped(7)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,104,487 (GRCm39) V733E probably benign Het
Adam34 A T 8: 44,105,041 (GRCm39) N201K probably benign Het
Aldh3b2 A C 19: 4,029,592 (GRCm39) S322R probably damaging Het
Anpep A T 7: 79,475,058 (GRCm39) L914Q probably damaging Het
Arhgap30 T C 1: 171,235,139 (GRCm39) F535S probably damaging Het
Baiap3 G A 17: 25,462,814 (GRCm39) R1075C probably benign Het
Baz2a G T 10: 127,948,475 (GRCm39) G252V probably damaging Het
Brinp3 T A 1: 146,776,812 (GRCm39) S420T possibly damaging Het
Carmil3 T C 14: 55,733,695 (GRCm39) F359S possibly damaging Het
Ccdc124 A T 8: 71,321,170 (GRCm39) L190Q probably damaging Het
Ccr6 T C 17: 8,474,972 (GRCm39) V59A probably damaging Het
Ccr8 T A 9: 119,923,683 (GRCm39) I266N probably damaging Het
Cdh23 T A 10: 60,167,596 (GRCm39) E1798V probably damaging Het
Cdk5rap2 T C 4: 70,153,684 (GRCm39) N1713S probably benign Het
Cep19 T A 16: 31,922,833 (GRCm39) I33N probably damaging Het
Cers3 A T 7: 66,433,163 (GRCm39) Y196F probably damaging Het
Cidea T C 18: 67,499,491 (GRCm39) I126T probably damaging Het
Copg2 A T 6: 30,789,689 (GRCm39) Y546* probably null Het
Cul3 A T 1: 80,264,717 (GRCm39) V261E probably benign Het
Cyp2g1 A T 7: 26,514,057 (GRCm39) D221V probably damaging Het
Cyp8b1 G A 9: 121,744,163 (GRCm39) H390Y probably damaging Het
Daam1 T C 12: 72,035,717 (GRCm39) F971L probably damaging Het
Dnajc24 G A 2: 105,832,311 (GRCm39) S24L possibly damaging Het
Dpysl3 T C 18: 43,571,107 (GRCm39) S56G probably benign Het
Esp1 A G 17: 41,041,972 (GRCm39) D88G probably benign Het
Fam171b A G 2: 83,708,574 (GRCm39) T359A probably damaging Het
Fam186b T C 15: 99,177,718 (GRCm39) E536G possibly damaging Het
Fbxo3 T C 2: 103,873,357 (GRCm39) V156A possibly damaging Het
Gls2 C A 10: 128,035,063 (GRCm39) H65Q probably benign Het
Gp2 A G 7: 119,050,721 (GRCm39) probably null Het
Gpcpd1 T A 2: 132,375,976 (GRCm39) K435I probably benign Het
Gpx6 T A 13: 21,501,840 (GRCm39) probably null Het
Hps3 A T 3: 20,084,583 (GRCm39) S202T probably benign Het
Htr1d T A 4: 136,170,812 (GRCm39) L347H probably damaging Het
Igfals T C 17: 25,100,208 (GRCm39) L433P probably damaging Het
Ilvbl C T 10: 78,419,530 (GRCm39) H537Y probably benign Het
Iqgap2 A T 13: 95,765,480 (GRCm39) M1530K probably damaging Het
Jarid2 A G 13: 45,049,798 (GRCm39) T247A possibly damaging Het
L3hypdh C T 12: 72,120,783 (GRCm39) V323I possibly damaging Het
Lama3 C T 18: 12,715,665 (GRCm39) T1707I possibly damaging Het
Map6 G T 7: 98,917,232 (GRCm39) A2S probably damaging Het
Mfap3 T A 11: 57,421,066 (GRCm39) I349K probably benign Het
Mybl2 A G 2: 162,914,625 (GRCm39) T248A probably benign Het
N6amt1 A G 16: 87,159,548 (GRCm39) *151W probably null Het
Nhlrc1 A G 13: 47,167,684 (GRCm39) V191A probably benign Het
Nkx2-5 T C 17: 27,058,594 (GRCm39) E120G possibly damaging Het
Or2y10 T A 11: 49,454,925 (GRCm39) M59K probably damaging Het
Or52r1b C A 7: 102,690,839 (GRCm39) T46N possibly damaging Het
Or8b41 T C 9: 38,055,049 (GRCm39) V201A probably benign Het
Or8k28 T A 2: 86,286,211 (GRCm39) I135F possibly damaging Het
Pcdha8 T G 18: 37,126,201 (GRCm39) L228V probably benign Het
Pcsk2 A G 2: 143,532,253 (GRCm39) T134A possibly damaging Het
Phldb3 G A 7: 24,324,078 (GRCm39) R484Q probably benign Het
Pipox A G 11: 77,772,012 (GRCm39) S371P probably damaging Het
Plekhg1 T C 10: 3,823,343 (GRCm39) S159P Het
Psme4 C T 11: 30,824,226 (GRCm39) P1737S probably benign Het
Pygm G A 19: 6,438,893 (GRCm39) D328N probably benign Het
Rabgef1 A T 5: 130,219,801 (GRCm39) E88V probably benign Het
Rims2 G T 15: 39,300,428 (GRCm39) R245L probably benign Het
Slc38a4 T C 15: 96,908,226 (GRCm39) I172V probably damaging Het
Slc4a10 T A 2: 62,099,009 (GRCm39) Y586N probably damaging Het
Snap91 C T 9: 86,761,610 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,178,480 (GRCm39) V881I probably benign Het
Spef2 A T 15: 9,601,726 (GRCm39) V1512E unknown Het
Sufu T C 19: 46,441,716 (GRCm39) I292T possibly damaging Het
Tet1 T C 10: 62,649,450 (GRCm39) N87D possibly damaging Het
Tmem108 T C 9: 103,376,733 (GRCm39) T239A not run Het
Tmem121 A T 12: 113,152,114 (GRCm39) K111* probably null Het
Tpp2 T A 1: 44,008,048 (GRCm39) D417E probably damaging Het
Tpr G A 1: 150,315,007 (GRCm39) E2025K possibly damaging Het
Trappc3 C T 4: 126,168,945 (GRCm39) A145V possibly damaging Het
Ttn T C 2: 76,721,325 (GRCm39) D6754G probably null Het
Unc13c T A 9: 73,536,473 (GRCm39) M1627L probably benign Het
Ush2a A G 1: 188,542,414 (GRCm39) I3327V probably benign Het
Vmn1r74 C T 7: 11,580,894 (GRCm39) Q65* probably null Het
Zbed5 G T 5: 129,929,279 (GRCm39) D132Y probably damaging Het
Zfp644 A T 5: 106,785,448 (GRCm39) Y366* probably null Het
Zfyve26 T C 12: 79,292,945 (GRCm39) N2068S probably damaging Het
Zic2 T C 14: 122,713,503 (GRCm39) F139S probably damaging Het
Zmynd11 T C 13: 9,760,198 (GRCm39) Q141R probably benign Het
Zrsr2-ps1 A G 11: 22,923,388 (GRCm39) E54G probably benign Het
Zscan10 G A 17: 23,828,456 (GRCm39) D333N probably benign Het
Other mutations in Wdr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Wdr18 APN 10 79,801,106 (GRCm39) missense probably damaging 1.00
IGL02812:Wdr18 APN 10 79,796,898 (GRCm39) missense possibly damaging 0.68
IGL02949:Wdr18 APN 10 79,800,889 (GRCm39) missense probably benign 0.00
R0066:Wdr18 UTSW 10 79,796,937 (GRCm39) nonsense probably null
R0066:Wdr18 UTSW 10 79,796,937 (GRCm39) nonsense probably null
R0244:Wdr18 UTSW 10 79,802,242 (GRCm39) missense probably damaging 1.00
R0257:Wdr18 UTSW 10 79,796,953 (GRCm39) splice site probably benign
R0377:Wdr18 UTSW 10 79,803,336 (GRCm39) missense probably benign 0.40
R1844:Wdr18 UTSW 10 79,802,561 (GRCm39) critical splice donor site probably null
R4179:Wdr18 UTSW 10 79,800,875 (GRCm39) missense probably damaging 1.00
R4674:Wdr18 UTSW 10 79,801,069 (GRCm39) missense probably benign
R5573:Wdr18 UTSW 10 79,800,872 (GRCm39) missense probably benign
R6007:Wdr18 UTSW 10 79,801,177 (GRCm39) missense possibly damaging 0.94
R6455:Wdr18 UTSW 10 79,801,115 (GRCm39) missense probably damaging 1.00
R7042:Wdr18 UTSW 10 79,801,944 (GRCm39) missense probably benign 0.22
R7316:Wdr18 UTSW 10 79,801,059 (GRCm39) missense probably benign 0.00
R7777:Wdr18 UTSW 10 79,801,884 (GRCm39) missense probably benign 0.06
R9117:Wdr18 UTSW 10 79,801,154 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGGAGCCATCTTAACAGTC -3'
(R):5'- GATCTTCATCTGAGCACGCG -3'

Sequencing Primer
(F):5'- GAGCCATCTTAACAGTCTCTCTAAGG -3'
(R):5'- CCATCTCCCTAGGAGAAAA -3'
Posted On 2019-06-26