Incidental Mutation 'R0575:Aggf1'
Institutional Source Beutler Lab
Gene Symbol Aggf1
Ensembl Gene ENSMUSG00000021681
Gene Nameangiogenic factor with G patch and FHA domains 1
Synonyms2010009L17Rik, 2310029P06Rik, VG5Q
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R0575 (G1)
Quality Score92
Status Validated
Chromosomal Location95350683-95375352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95368397 bp
Amino Acid Change Threonine to Serine at position 285 (T285S)
Ref Sequence ENSEMBL: ENSMUSP00000022189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022189]
Predicted Effect probably benign
Transcript: ENSMUST00000022189
AA Change: T285S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022189
Gene: ENSMUSG00000021681
AA Change: T285S

coiled coil region 20 85 N/A INTRINSIC
low complexity region 128 137 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
internal_repeat_1 205 225 4.68e-9 PROSPERO
internal_repeat_1 221 241 4.68e-9 PROSPERO
low complexity region 270 280 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 380 401 N/A INTRINSIC
FHA 430 484 1.51e-9 SMART
low complexity region 548 561 N/A INTRINSIC
G_patch 614 660 1.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161671
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor that promotes proliferation of endothelial cells. Mutations in this gene are associated with a susceptibility to Klippel-Trenaunay syndrome. Pseudogenes of this gene are found on chromosomes 3, 4, 10 and 16.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null embryos die before E8.5. Heterozygotes exhibit defective angiogenesis in yolk sacs and embryos and partial lethality. Surviving adults show hemorrhages, increased vascular permeability, and reduced tumor growth of implanted melanoma cell lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Aggf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Aggf1 APN 13 95362477 missense probably damaging 1.00
IGL01083:Aggf1 APN 13 95356409 missense probably damaging 1.00
IGL01296:Aggf1 APN 13 95353971 missense probably damaging 1.00
IGL01811:Aggf1 APN 13 95351572 missense probably benign 0.04
IGL02089:Aggf1 APN 13 95370929 missense probably benign 0.22
IGL02351:Aggf1 APN 13 95352850 splice site probably benign
IGL02358:Aggf1 APN 13 95352850 splice site probably benign
IGL02534:Aggf1 APN 13 95369522 missense possibly damaging 0.76
PIT4687001:Aggf1 UTSW 13 95364875 missense probably damaging 0.99
R0090:Aggf1 UTSW 13 95364959 missense probably benign 0.01
R0189:Aggf1 UTSW 13 95356480 splice site probably benign
R0332:Aggf1 UTSW 13 95369446 missense probably damaging 1.00
R0334:Aggf1 UTSW 13 95371597 missense probably benign 0.02
R0445:Aggf1 UTSW 13 95354001 missense possibly damaging 0.74
R0523:Aggf1 UTSW 13 95356416 missense probably damaging 0.99
R0647:Aggf1 UTSW 13 95371656 splice site probably null
R1401:Aggf1 UTSW 13 95364848 missense probably benign 0.02
R1495:Aggf1 UTSW 13 95356413 nonsense probably null
R1542:Aggf1 UTSW 13 95370942 missense probably benign 0.00
R1688:Aggf1 UTSW 13 95364767 missense probably damaging 1.00
R2225:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R2226:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R4405:Aggf1 UTSW 13 95371594 missense probably benign 0.00
R4764:Aggf1 UTSW 13 95364713 missense probably damaging 0.96
R5819:Aggf1 UTSW 13 95351621 missense possibly damaging 0.76
R5878:Aggf1 UTSW 13 95369557 missense probably benign 0.18
R5946:Aggf1 UTSW 13 95371576 missense probably damaging 1.00
R6056:Aggf1 UTSW 13 95371615 missense probably benign 0.00
R6823:Aggf1 UTSW 13 95364723 missense probably benign 0.11
R7051:Aggf1 UTSW 13 95351617 missense possibly damaging 0.94
R7638:Aggf1 UTSW 13 95356413 nonsense probably null
R7682:Aggf1 UTSW 13 95368426 missense probably benign 0.41
R7903:Aggf1 UTSW 13 95356458 missense probably damaging 1.00
RF014:Aggf1 UTSW 13 95370768 missense possibly damaging 0.87
X0010:Aggf1 UTSW 13 95364977 missense probably benign
X0064:Aggf1 UTSW 13 95362870 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gaggcagaggcaggcag -3'
Posted On2013-07-11