Incidental Mutation 'R0575:4931414P19Rik'
ID56197
Institutional Source Beutler Lab
Gene Symbol 4931414P19Rik
Ensembl Gene ENSMUSG00000022179
Gene NameRIKEN cDNA 4931414P19 gene
Synonyms
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0575 (G1)
Quality Score193
Status Validated
Chromosome14
Chromosomal Location54583663-54605993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54591252 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 264 (S264N)
Ref Sequence ENSEMBL: ENSMUSP00000022786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022786]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022786
AA Change: S264N

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022786
Gene: ENSMUSG00000022179
AA Change: S264N

DomainStartEndE-ValueType
Pfam:DUF4616 2 538 1.5e-263 PFAM
Meta Mutation Damage Score 0.1025 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in 4931414P19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:4931414P19Rik APN 14 54595578 missense possibly damaging 0.56
IGL01448:4931414P19Rik APN 14 54585960 missense possibly damaging 0.77
IGL01934:4931414P19Rik APN 14 54585655 missense probably damaging 1.00
IGL02194:4931414P19Rik APN 14 54591355 nonsense probably null
IGL02721:4931414P19Rik APN 14 54585745 missense probably damaging 1.00
IGL03124:4931414P19Rik APN 14 54595139 missense probably benign 0.00
R2049:4931414P19Rik UTSW 14 54584987 nonsense probably null
R3829:4931414P19Rik UTSW 14 54584509 missense probably damaging 1.00
R3876:4931414P19Rik UTSW 14 54591400 nonsense probably null
R4392:4931414P19Rik UTSW 14 54584978 critical splice donor site probably null
R4680:4931414P19Rik UTSW 14 54585076 missense probably damaging 1.00
R4805:4931414P19Rik UTSW 14 54595454 missense probably benign 0.00
R4940:4931414P19Rik UTSW 14 54591325 missense probably benign
R5091:4931414P19Rik UTSW 14 54585711 missense probably damaging 1.00
R5291:4931414P19Rik UTSW 14 54585937 missense probably damaging 1.00
R5594:4931414P19Rik UTSW 14 54584984 missense probably damaging 1.00
R6815:4931414P19Rik UTSW 14 54591153 missense probably damaging 1.00
R7031:4931414P19Rik UTSW 14 54595601 missense probably benign 0.23
R7229:4931414P19Rik UTSW 14 54595352 missense probably benign 0.00
R7616:4931414P19Rik UTSW 14 54585666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGCCAATGCTCCAGGTTATG -3'
(R):5'- TTCAATACAACGAGTGCTGGTCCC -3'

Sequencing Primer
(F):5'- CTCCAGGTTATGCAGTAAGGC -3'
(R):5'- GTCCCCGCTTATGCCAAAC -3'
Posted On2013-07-11